Incidental Mutation 'R1605:D430041D05Rik'
ID176378
Institutional Source Beutler Lab
Gene Symbol D430041D05Rik
Ensembl Gene ENSMUSG00000068373
Gene NameRIKEN cDNA D430041D05 gene
SynonymsG2
MMRRC Submission 039642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1605 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104143073-104411013 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104255570 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 22 (V22A)
Ref Sequence ENSEMBL: ENSMUSP00000124980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089726] [ENSMUST00000136156] [ENSMUST00000141159] [ENSMUST00000149466] [ENSMUST00000230671]
Predicted Effect probably benign
Transcript: ENSMUST00000089726
AA Change: V194A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106756
Gene: ENSMUSG00000068373
AA Change: V194A

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 206 215 N/A INTRINSIC
low complexity region 218 230 N/A INTRINSIC
low complexity region 234 253 N/A INTRINSIC
Pfam:DUF3827 498 1134 2.4e-282 PFAM
low complexity region 1196 1217 N/A INTRINSIC
low complexity region 1331 1351 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136156
AA Change: V194A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect
SMART Domains Protein: ENSMUSP00000124519
Gene: ENSMUSG00000068373
AA Change: V137A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
low complexity region 162 174 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141159
AA Change: V79A
SMART Domains Protein: ENSMUSP00000117041
Gene: ENSMUSG00000068373
AA Change: V79A

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 91 100 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
Pfam:DUF3827 383 1020 8.2e-280 PFAM
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1217 1237 N/A INTRINSIC
low complexity region 1246 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149165
Predicted Effect possibly damaging
Transcript: ENSMUST00000149466
AA Change: V22A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124980
Gene: ENSMUSG00000068373
AA Change: V22A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 34 43 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
low complexity region 62 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151310
Predicted Effect probably benign
Transcript: ENSMUST00000230671
AA Change: V878A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik T A 7: 4,151,396 H131L probably benign Het
1700123L14Rik A G 6: 96,164,812 M417T probably benign Het
4931408C20Rik A T 1: 26,684,430 H556Q possibly damaging Het
5730409E04Rik A G 4: 126,612,311 K211E probably damaging Het
Acot7 A G 4: 152,206,828 I84V possibly damaging Het
Ankrd44 A G 1: 54,828,622 V34A probably benign Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Atr T A 9: 95,936,463 I2163K probably damaging Het
Azgp1 A T 5: 137,985,164 R34* probably null Het
Ccdc152 T G 15: 3,298,121 K58T probably damaging Het
Ccdc88b T A 19: 6,850,469 Q912L probably benign Het
Chd7 G A 4: 8,844,675 E1595K probably damaging Het
Col11a1 G A 3: 114,131,641 G41D probably damaging Het
Cyp2b23 C T 7: 26,686,418 V5I probably benign Het
Ddi1 T C 9: 6,266,012 Y119C probably benign Het
Dysf T C 6: 84,106,941 L785P probably damaging Het
Eqtn T A 4: 94,928,350 T69S possibly damaging Het
F11 T A 8: 45,241,580 K581N probably damaging Het
Gli2 G A 1: 118,854,560 P172S probably damaging Het
Gm10093 A G 17: 78,492,108 D176G probably damaging Het
Gm7579 G T 7: 142,211,866 C3F unknown Het
Grin2a A G 16: 9,663,330 V501A possibly damaging Het
Grk4 G A 5: 34,674,557 D57N probably damaging Het
Gsdma A T 11: 98,666,493 D86V probably damaging Het
Gsx1 A G 5: 147,189,928 E187G probably damaging Het
Inpp5k T A 11: 75,633,481 F75L probably benign Het
Itpr1 T C 6: 108,349,659 V114A possibly damaging Het
Izumo3 A T 4: 92,144,740 C130S probably damaging Het
Mei4 G A 9: 81,927,586 E241K possibly damaging Het
Mocs2 T C 13: 114,824,584 V39A probably benign Het
Mroh2b G A 15: 4,945,090 R1184H probably benign Het
Msh3 T C 13: 92,300,275 Q509R probably null Het
Myh8 T C 11: 67,301,671 W1459R probably damaging Het
Mypop T A 7: 19,000,993 probably benign Het
Ndc1 C A 4: 107,368,096 T3K probably damaging Het
Nf1 A C 11: 79,440,923 M695L probably benign Het
Nutm2 C A 13: 50,469,919 D217E possibly damaging Het
Olfr1484 A G 19: 13,585,630 T109A probably benign Het
Olfr243 T C 7: 103,716,651 I19T probably damaging Het
Pde6c C A 19: 38,141,492 D283E probably damaging Het
Phldb2 A G 16: 45,770,779 probably benign Het
Pigt G C 2: 164,507,499 R574P probably damaging Het
Pkd1 T C 17: 24,577,526 I2354T possibly damaging Het
Prdm15 T C 16: 97,839,306 E27G probably damaging Het
Ptpn14 A G 1: 189,865,512 I1140V probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rfx7 T C 9: 72,611,789 S258P probably damaging Het
Rnf17 G T 14: 56,493,365 G1209C probably damaging Het
S1pr4 C T 10: 81,499,391 probably null Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpinb1b T A 13: 33,093,663 V293E possibly damaging Het
Serpinb9b T C 13: 33,038,129 probably null Het
Sez6l A C 5: 112,475,049 I212S probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag9 G A 11: 94,048,539 R98H probably damaging Het
St3gal5 T C 6: 72,142,288 L128P probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Stxbp5l A G 16: 37,208,111 V530A probably benign Het
Tatdn1 A G 15: 58,921,190 probably benign Het
Tbc1d8 A G 1: 39,391,125 S466P probably benign Het
Tmem199 A T 11: 78,508,326 M175K possibly damaging Het
Trmt12 A G 15: 58,872,915 E54G probably benign Het
Usp37 G T 1: 74,493,004 Q77K possibly damaging Het
Vezf1 A G 11: 88,076,299 I301V possibly damaging Het
Vmn1r34 T G 6: 66,636,948 M269L probably benign Het
Wdr93 C A 7: 79,771,509 probably null Het
Wnk2 T C 13: 49,060,894 D644G probably damaging Het
Zc3h13 C T 14: 75,337,483 R1591* probably null Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp180 T A 7: 24,104,624 V156D probably benign Het
Zfp646 G T 7: 127,880,187 probably null Het
Zscan12 C A 13: 21,366,643 T144K probably benign Het
Other mutations in D430041D05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:D430041D05Rik APN 2 104201303 missense probably damaging 1.00
IGL01114:D430041D05Rik APN 2 104258166 nonsense probably null
IGL01669:D430041D05Rik APN 2 104254961 missense probably damaging 1.00
IGL02015:D430041D05Rik APN 2 104230404 missense probably damaging 1.00
IGL02037:D430041D05Rik APN 2 104208214 splice site probably benign
IGL02268:D430041D05Rik APN 2 104241155 missense possibly damaging 0.80
IGL02294:D430041D05Rik APN 2 104255006 missense probably benign 0.42
IGL02457:D430041D05Rik APN 2 104249345 missense probably damaging 0.99
IGL02601:D430041D05Rik APN 2 104230286 missense probably damaging 0.99
IGL02647:D430041D05Rik APN 2 104248266 missense probably damaging 1.00
IGL02679:D430041D05Rik APN 2 104230305 missense possibly damaging 0.80
IGL02926:D430041D05Rik APN 2 104214259 missense probably damaging 1.00
IGL03171:D430041D05Rik APN 2 104241163 missense possibly damaging 0.95
IGL03178:D430041D05Rik APN 2 104221211 missense probably damaging 1.00
IGL03371:D430041D05Rik APN 2 104248374 missense probably damaging 1.00
R0027:D430041D05Rik UTSW 2 104255044 missense probably benign
R0064:D430041D05Rik UTSW 2 104249157 missense probably damaging 1.00
R0135:D430041D05Rik UTSW 2 104255034 missense possibly damaging 0.60
R0227:D430041D05Rik UTSW 2 104205200 missense possibly damaging 0.85
R0265:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0268:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0282:D430041D05Rik UTSW 2 104201244 missense probably damaging 1.00
R0366:D430041D05Rik UTSW 2 104255340 missense probably damaging 0.99
R0402:D430041D05Rik UTSW 2 104168164 missense probably damaging 0.99
R0436:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0441:D430041D05Rik UTSW 2 104167947 missense probably damaging 1.00
R0540:D430041D05Rik UTSW 2 104233445 missense probably damaging 1.00
R0607:D430041D05Rik UTSW 2 104233445 missense probably damaging 1.00
R0613:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0626:D430041D05Rik UTSW 2 104167950 missense probably damaging 1.00
R0747:D430041D05Rik UTSW 2 104230306 missense probably damaging 1.00
R0864:D430041D05Rik UTSW 2 104230428 missense possibly damaging 0.78
R0980:D430041D05Rik UTSW 2 104249345 missense probably damaging 0.99
R1014:D430041D05Rik UTSW 2 104258329 missense possibly damaging 0.94
R1254:D430041D05Rik UTSW 2 104201303 missense probably damaging 1.00
R1364:D430041D05Rik UTSW 2 104155018 missense possibly damaging 0.93
R1456:D430041D05Rik UTSW 2 104208083 missense probably damaging 1.00
R1574:D430041D05Rik UTSW 2 104221208 small deletion probably benign
R1604:D430041D05Rik UTSW 2 104205142 missense probably damaging 1.00
R1623:D430041D05Rik UTSW 2 104152963 missense probably damaging 1.00
R1634:D430041D05Rik UTSW 2 104221211 missense probably damaging 1.00
R1834:D430041D05Rik UTSW 2 104168101 missense probably damaging 1.00
R1885:D430041D05Rik UTSW 2 104230455 missense probably benign 0.39
R2080:D430041D05Rik UTSW 2 104156816 missense probably damaging 1.00
R2101:D430041D05Rik UTSW 2 104148830 missense probably damaging 1.00
R2240:D430041D05Rik UTSW 2 104156816 missense probably damaging 1.00
R2923:D430041D05Rik UTSW 2 104255315 missense possibly damaging 0.94
R3751:D430041D05Rik UTSW 2 104255058 missense possibly damaging 0.94
R3862:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3863:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3864:D430041D05Rik UTSW 2 104214177 missense possibly damaging 0.54
R3949:D430041D05Rik UTSW 2 104257368 missense probably benign 0.02
R4493:D430041D05Rik UTSW 2 104256339 missense probably benign 0.02
R4526:D430041D05Rik UTSW 2 104192433 critical splice donor site probably null
R4592:D430041D05Rik UTSW 2 104233479 missense possibly damaging 0.89
R4598:D430041D05Rik UTSW 2 104208183 missense probably damaging 0.99
R4599:D430041D05Rik UTSW 2 104208183 missense probably damaging 0.99
R4647:D430041D05Rik UTSW 2 104258443 missense probably damaging 0.99
R4765:D430041D05Rik UTSW 2 104214096 missense probably damaging 1.00
R4808:D430041D05Rik UTSW 2 104201110 critical splice donor site probably null
R4868:D430041D05Rik UTSW 2 104255409 missense possibly damaging 0.73
R4982:D430041D05Rik UTSW 2 104255387 missense possibly damaging 0.46
R5144:D430041D05Rik UTSW 2 104258502 missense probably damaging 0.99
R5255:D430041D05Rik UTSW 2 104256600 missense probably benign 0.26
R5356:D430041D05Rik UTSW 2 104255409 missense probably damaging 0.99
R5368:D430041D05Rik UTSW 2 104248284 missense probably damaging 0.99
R5963:D430041D05Rik UTSW 2 104248285 missense possibly damaging 0.66
R5993:D430041D05Rik UTSW 2 104168067 missense probably damaging 1.00
R6122:D430041D05Rik UTSW 2 104256292 missense probably benign 0.01
R6410:D430041D05Rik UTSW 2 104168203 splice site probably null
R6804:D430041D05Rik UTSW 2 104149026 missense possibly damaging 0.85
R6850:D430041D05Rik UTSW 2 104201259 missense probably damaging 1.00
R6853:D430041D05Rik UTSW 2 104241155 missense probably damaging 1.00
R7034:D430041D05Rik UTSW 2 104192538 missense probably damaging 0.99
R7146:D430041D05Rik UTSW 2 104258353 missense probably benign 0.06
X0024:D430041D05Rik UTSW 2 104192566 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTGTGTTGTGGACAACAGGC -3'
(R):5'- TTCAGTAGTGAGGTGCAGCTCCAG -3'

Sequencing Primer
(F):5'- ACACAGAGCCTGTTGCC -3'
(R):5'- TGCTGTAAGCGGCATTCTC -3'
Posted On2014-04-24