Incidental Mutation 'R1774:Ep400'
ID196909
Institutional Source Beutler Lab
Gene Symbol Ep400
Ensembl Gene ENSMUSG00000029505
Gene NameE1A binding protein p400
SynonymsmDomino, 1700020J09Rik, p400
MMRRC Submission 039805-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1774 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location110664373-110770717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110685491 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1955 (C1955F)
Ref Sequence ENSEMBL: ENSMUSP00000108055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]
Predicted Effect unknown
Transcript: ENSMUST00000041558
AA Change: C1991F
SMART Domains Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: C1991F

DomainStartEndE-ValueType
Pfam:EP400_N 1 461 1.6e-232 PFAM
low complexity region 519 532 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 598 620 N/A INTRINSIC
low complexity region 631 645 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
HSA 762 833 1.31e-31 SMART
low complexity region 908 925 N/A INTRINSIC
DEXDc 1049 1238 2.76e-15 SMART
Blast:DEXDc 1276 1317 2e-15 BLAST
low complexity region 1407 1417 N/A INTRINSIC
HELICc 1807 1893 1.17e-4 SMART
low complexity region 2006 2019 N/A INTRINSIC
low complexity region 2080 2100 N/A INTRINSIC
low complexity region 2214 2223 N/A INTRINSIC
SANT 2243 2310 3.57e-1 SMART
low complexity region 2402 2489 N/A INTRINSIC
low complexity region 2596 2608 N/A INTRINSIC
low complexity region 2644 2679 N/A INTRINSIC
low complexity region 2694 2738 N/A INTRINSIC
low complexity region 2769 2806 N/A INTRINSIC
low complexity region 2846 2883 N/A INTRINSIC
low complexity region 2933 2947 N/A INTRINSIC
low complexity region 2974 2986 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112435
AA Change: C1872F
SMART Domains Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: C1872F

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 447 N/A INTRINSIC
low complexity region 471 485 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 635 657 N/A INTRINSIC
low complexity region 668 682 N/A INTRINSIC
low complexity region 695 723 N/A INTRINSIC
HSA 799 870 1.31e-31 SMART
low complexity region 945 962 N/A INTRINSIC
DEXDc 1086 1275 2.76e-15 SMART
Blast:DEXDc 1313 1354 2e-15 BLAST
low complexity region 1444 1454 N/A INTRINSIC
internal_repeat_1 1556 1646 6.82e-5 PROSPERO
low complexity region 1887 1900 N/A INTRINSIC
low complexity region 1961 1981 N/A INTRINSIC
low complexity region 2095 2104 N/A INTRINSIC
SANT 2124 2191 3.57e-1 SMART
low complexity region 2283 2370 N/A INTRINSIC
internal_repeat_1 2371 2463 6.82e-5 PROSPERO
low complexity region 2477 2489 N/A INTRINSIC
low complexity region 2525 2560 N/A INTRINSIC
low complexity region 2575 2619 N/A INTRINSIC
low complexity region 2645 2659 N/A INTRINSIC
low complexity region 2660 2680 N/A INTRINSIC
low complexity region 2720 2757 N/A INTRINSIC
low complexity region 2807 2821 N/A INTRINSIC
low complexity region 2848 2860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112436
AA Change: C1955F
SMART Domains Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: C1955F

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 262 287 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
low complexity region 313 329 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 472 482 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
low complexity region 562 584 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
HSA 726 797 1.31e-31 SMART
low complexity region 872 889 N/A INTRINSIC
DEXDc 1013 1202 2.76e-15 SMART
Blast:DEXDc 1240 1281 2e-15 BLAST
low complexity region 1371 1381 N/A INTRINSIC
internal_repeat_1 1483 1573 6.76e-5 PROSPERO
HELICc 1771 1857 1.17e-4 SMART
low complexity region 1970 1983 N/A INTRINSIC
low complexity region 2044 2064 N/A INTRINSIC
low complexity region 2178 2187 N/A INTRINSIC
SANT 2207 2274 3.57e-1 SMART
low complexity region 2366 2453 N/A INTRINSIC
internal_repeat_1 2454 2546 6.76e-5 PROSPERO
low complexity region 2560 2572 N/A INTRINSIC
low complexity region 2608 2643 N/A INTRINSIC
low complexity region 2658 2702 N/A INTRINSIC
low complexity region 2733 2770 N/A INTRINSIC
low complexity region 2810 2847 N/A INTRINSIC
low complexity region 2897 2911 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129884
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T C 5: 145,045,541 V312A probably damaging Het
2810408A11Rik A G 11: 69,900,627 V42A probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt1 T A 15: 42,523,616 Q114L probably damaging Het
Apc2 T C 10: 80,309,130 I625T probably damaging Het
Atg2a T C 19: 6,250,598 V735A probably benign Het
Birc6 T A 17: 74,640,013 I2909N probably damaging Het
C7 C G 15: 5,012,075 D450H probably damaging Het
Cachd1 C T 4: 100,964,435 T403I probably damaging Het
Cachd1 T A 4: 100,967,043 F560L probably benign Het
Cacna2d2 A T 9: 107,526,151 Y944F probably benign Het
Cdkal1 C T 13: 29,850,048 D21N probably damaging Het
Col18a1 T C 10: 77,059,981 R901G probably damaging Het
Col27a1 C T 4: 63,225,713 P546L probably damaging Het
Cps1 C T 1: 67,170,882 R624W possibly damaging Het
Cyp11a1 A T 9: 58,018,360 I93F probably benign Het
Cyp2c40 G C 19: 39,786,806 T334R probably damaging Het
Cyp4f37 A G 17: 32,629,890 D244G possibly damaging Het
D630003M21Rik A T 2: 158,220,470 D43E probably damaging Het
Ethe1 G A 7: 24,593,946 V6I probably benign Het
F5 C A 1: 164,192,535 Q860K probably benign Het
Fasn T C 11: 120,817,171 Y685C probably damaging Het
Gga2 T G 7: 122,012,221 D38A probably damaging Het
Gm12794 G A 4: 101,940,458 V18M probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm43302 T A 5: 105,275,794 I438F probably benign Het
Grm1 T A 10: 11,079,866 T225S possibly damaging Het
Hic2 G T 16: 17,258,647 V447L probably damaging Het
Hsf2 G A 10: 57,512,146 C462Y probably damaging Het
Ice1 T C 13: 70,604,553 D1138G probably damaging Het
Il6 A G 5: 30,019,435 T158A probably benign Het
Inpp5d T A 1: 87,667,889 V120E probably benign Het
Iqca T C 1: 90,080,903 N456S probably benign Het
Itgal T A 7: 127,309,622 probably null Het
Lrrc66 G C 5: 73,610,855 Q248E probably benign Het
Lrrc7 T A 3: 158,160,292 M1271L possibly damaging Het
Lrrc74a T C 12: 86,749,053 S267P probably damaging Het
Map2 T C 1: 66,414,074 S550P probably damaging Het
Mapk8ip3 A T 17: 24,924,145 probably null Het
Mdm4 A C 1: 132,996,646 S246A probably damaging Het
Med23 A G 10: 24,903,686 E887G probably damaging Het
Mgea5 T C 19: 45,776,984 E128G probably benign Het
Mta1 C T 12: 113,128,039 A254V probably damaging Het
Myh2 A G 11: 67,173,474 Y85C possibly damaging Het
Myo1g A G 11: 6,515,988 Y366H probably damaging Het
Nalcn G A 14: 123,278,266 P1708S probably benign Het
Nlrp9c A T 7: 26,394,118 S41T probably benign Het
Nptx2 T A 5: 144,553,438 S226T possibly damaging Het
Nup85 T A 11: 115,582,945 S562T probably benign Het
Nxpe5 T C 5: 138,239,535 V107A probably benign Het
Olfr129 A G 17: 38,055,437 V43A probably benign Het
Olfr273 T A 4: 52,855,674 I280F probably benign Het
Olfr414 A G 1: 174,431,339 T304A probably benign Het
Olfr455 A T 6: 42,538,519 F168I probably damaging Het
Pcdhb12 C T 18: 37,436,442 P214S possibly damaging Het
Pcdhb5 T A 18: 37,322,672 F702I probably damaging Het
Pcnx T C 12: 81,975,320 F1475S probably damaging Het
Pde5a C A 3: 122,729,364 T40N probably benign Het
Pnpla2 T A 7: 141,459,568 V398E probably damaging Het
Rab20 T C 8: 11,454,223 K159R probably benign Het
Rfwd3 C T 8: 111,288,242 R326Q probably damaging Het
Rgs12 T A 5: 34,966,403 V510D probably benign Het
Rnf219 A G 14: 104,479,662 V425A possibly damaging Het
Slamf6 T C 1: 171,942,587 probably benign Het
Slc27a5 A T 7: 12,997,607 C23* probably null Het
Slc35e2 T C 4: 155,610,164 V56A possibly damaging Het
Slx4ip T C 2: 137,067,723 S143P probably damaging Het
Stat5a C T 11: 100,879,286 S463F probably damaging Het
Svep1 T C 4: 58,146,562 D360G possibly damaging Het
Tas2r143 A T 6: 42,400,371 D45V probably damaging Het
Tdrd5 G T 1: 156,277,509 R516S probably damaging Het
Thy1 A G 9: 44,047,339 D126G probably benign Het
Tspear C T 10: 77,873,185 T415I probably benign Het
Ttll5 C A 12: 85,933,402 T920K probably benign Het
Umod T C 7: 119,477,351 E64G possibly damaging Het
Usf3 A G 16: 44,215,670 N171S probably damaging Het
Vmn1r23 T A 6: 57,926,690 R34S probably damaging Het
Wasf1 C G 10: 40,934,479 P239R possibly damaging Het
Wdr95 C T 5: 149,564,392 R164* probably null Het
Zan C A 5: 137,419,989 C2949F unknown Het
Zbed4 T C 15: 88,780,877 S383P probably benign Het
Zcchc11 T C 4: 108,507,955 F542L probably damaging Het
Zfand5 T A 19: 21,276,531 C33S probably damaging Het
Zfp12 A G 5: 143,245,229 Y437C probably damaging Het
Zfp451 A C 1: 33,813,768 S22A probably benign Het
Other mutations in Ep400
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ep400 APN 5 110687841 missense unknown
IGL00585:Ep400 APN 5 110755905 missense possibly damaging 0.70
IGL00586:Ep400 APN 5 110739594 missense probably damaging 1.00
IGL00816:Ep400 APN 5 110735490 unclassified probably benign
IGL01066:Ep400 APN 5 110668199 splice site probably benign
IGL01302:Ep400 APN 5 110742048 missense probably benign 0.00
IGL01568:Ep400 APN 5 110719495 missense unknown
IGL01833:Ep400 APN 5 110680008 missense unknown
IGL02086:Ep400 APN 5 110676943 splice site probably benign
IGL02266:Ep400 APN 5 110695297 unclassified probably benign
IGL02288:Ep400 APN 5 110683836 splice site probably benign
IGL02301:Ep400 APN 5 110674960 missense probably damaging 1.00
IGL02377:Ep400 APN 5 110720825 missense unknown
IGL02382:Ep400 APN 5 110701728 missense unknown
IGL02419:Ep400 APN 5 110697376 splice site probably null
IGL02591:Ep400 APN 5 110733772 unclassified probably benign
IGL02981:Ep400 APN 5 110756103 missense possibly damaging 0.79
IGL02981:Ep400 APN 5 110691610 splice site probably benign
IGL03173:Ep400 APN 5 110708871 unclassified probably benign
IGL03244:Ep400 APN 5 110727563 missense unknown
IGL03333:Ep400 APN 5 110703566 missense unknown
santol UTSW 5 110701671 missense unknown
PIT4243001:Ep400 UTSW 5 110735580 missense unknown
PIT4260001:Ep400 UTSW 5 110693171 nonsense probably null
R0017:Ep400 UTSW 5 110673529 missense probably damaging 1.00
R0179:Ep400 UTSW 5 110668649 missense probably damaging 0.99
R0243:Ep400 UTSW 5 110724407 splice site probably benign
R0366:Ep400 UTSW 5 110701671 missense unknown
R0508:Ep400 UTSW 5 110739508 missense probably benign 0.00
R0541:Ep400 UTSW 5 110705016 missense unknown
R0558:Ep400 UTSW 5 110685067 splice site probably benign
R0576:Ep400 UTSW 5 110711093 unclassified probably benign
R0595:Ep400 UTSW 5 110703542 missense unknown
R0671:Ep400 UTSW 5 110688196 missense unknown
R0763:Ep400 UTSW 5 110665837 missense probably damaging 1.00
R1078:Ep400 UTSW 5 110735522 unclassified probably benign
R1300:Ep400 UTSW 5 110673560 missense probably damaging 1.00
R1439:Ep400 UTSW 5 110685478 missense unknown
R1520:Ep400 UTSW 5 110691778 intron probably benign
R1529:Ep400 UTSW 5 110739445 missense probably benign 0.00
R1535:Ep400 UTSW 5 110708166 unclassified probably benign
R1560:Ep400 UTSW 5 110671106 splice site probably null
R1587:Ep400 UTSW 5 110726902 missense probably benign 0.23
R1596:Ep400 UTSW 5 110708861 unclassified probably benign
R1653:Ep400 UTSW 5 110693174 nonsense probably null
R1711:Ep400 UTSW 5 110693308 unclassified probably benign
R1836:Ep400 UTSW 5 110705054 missense unknown
R1905:Ep400 UTSW 5 110670948 missense probably damaging 1.00
R1917:Ep400 UTSW 5 110703575 missense unknown
R2064:Ep400 UTSW 5 110735404 unclassified probably benign
R2122:Ep400 UTSW 5 110708850 unclassified probably benign
R2144:Ep400 UTSW 5 110703518 missense unknown
R2215:Ep400 UTSW 5 110693555 unclassified probably benign
R2252:Ep400 UTSW 5 110719091 missense unknown
R2253:Ep400 UTSW 5 110719091 missense unknown
R2483:Ep400 UTSW 5 110719236 missense unknown
R2504:Ep400 UTSW 5 110668645 missense probably damaging 1.00
R2512:Ep400 UTSW 5 110708915 unclassified probably benign
R2842:Ep400 UTSW 5 110698815 nonsense probably null
R2920:Ep400 UTSW 5 110755914 missense probably damaging 1.00
R3082:Ep400 UTSW 5 110693230 unclassified probably benign
R3151:Ep400 UTSW 5 110703569 missense unknown
R3552:Ep400 UTSW 5 110729287 missense unknown
R3623:Ep400 UTSW 5 110719236 missense unknown
R3779:Ep400 UTSW 5 110691649 missense unknown
R3923:Ep400 UTSW 5 110756523 missense possibly damaging 0.55
R4062:Ep400 UTSW 5 110741981 missense probably benign 0.10
R4508:Ep400 UTSW 5 110703615 missense unknown
R4584:Ep400 UTSW 5 110733897 unclassified probably benign
R4585:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4586:Ep400 UTSW 5 110753859 missense probably damaging 1.00
R4807:Ep400 UTSW 5 110695578 intron probably null
R4921:Ep400 UTSW 5 110665810 missense probably damaging 1.00
R4976:Ep400 UTSW 5 110698812 missense unknown
R4976:Ep400 UTSW 5 110720756 missense unknown
R5075:Ep400 UTSW 5 110685485 missense unknown
R5120:Ep400 UTSW 5 110756358 missense probably damaging 1.00
R5122:Ep400 UTSW 5 110668170 missense probably damaging 1.00
R5223:Ep400 UTSW 5 110668630 missense probably damaging 1.00
R5284:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R5388:Ep400 UTSW 5 110701728 missense unknown
R5401:Ep400 UTSW 5 110683171 missense unknown
R5431:Ep400 UTSW 5 110676554 missense unknown
R5461:Ep400 UTSW 5 110676684 nonsense probably null
R5568:Ep400 UTSW 5 110756205 missense probably damaging 1.00
R5650:Ep400 UTSW 5 110695952 critical splice donor site probably null
R5778:Ep400 UTSW 5 110719584 missense unknown
R5806:Ep400 UTSW 5 110755554 nonsense probably null
R5814:Ep400 UTSW 5 110695578 intron probably null
R5830:Ep400 UTSW 5 110683996 missense unknown
R5882:Ep400 UTSW 5 110755587 missense probably benign 0.00
R5931:Ep400 UTSW 5 110735520 unclassified probably benign
R5945:Ep400 UTSW 5 110682866 missense unknown
R5966:Ep400 UTSW 5 110676900 missense unknown
R5973:Ep400 UTSW 5 110729831 missense unknown
R5980:Ep400 UTSW 5 110733729 unclassified probably benign
R6000:Ep400 UTSW 5 110683201 missense unknown
R6006:Ep400 UTSW 5 110704959 missense unknown
R6053:Ep400 UTSW 5 110755795 missense probably benign 0.22
R6145:Ep400 UTSW 5 110756703 missense possibly damaging 0.95
R6154:Ep400 UTSW 5 110755933 missense probably damaging 0.97
R6169:Ep400 UTSW 5 110741997 missense possibly damaging 0.83
R6228:Ep400 UTSW 5 110670942 missense probably damaging 1.00
R6295:Ep400 UTSW 5 110753809 missense probably benign 0.00
R6486:Ep400 UTSW 5 110697218 unclassified probably benign
R6504:Ep400 UTSW 5 110708837 unclassified probably benign
R6607:Ep400 UTSW 5 110683314 missense unknown
R6657:Ep400 UTSW 5 110693545 unclassified probably benign
R6660:Ep400 UTSW 5 110719447 nonsense probably null
R6741:Ep400 UTSW 5 110676895 missense unknown
R6933:Ep400 UTSW 5 110665862 missense probably damaging 1.00
R6937:Ep400 UTSW 5 110711152 unclassified probably benign
R7069:Ep400 UTSW 5 110668124 missense probably damaging 1.00
R7103:Ep400 UTSW 5 110733785 missense unknown
R7156:Ep400 UTSW 5 110685363 missense unknown
R7272:Ep400 UTSW 5 110755645 nonsense probably null
R7365:Ep400 UTSW 5 110719614 missense unknown
X0012:Ep400 UTSW 5 110673196 small deletion probably benign
X0021:Ep400 UTSW 5 110682864 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCCAAGTTGCTTCCAAACTAGTGC -3'
(R):5'- ATCGGAATGCCTATCATCCAGCCC -3'

Sequencing Primer
(F):5'- CAGTGGTCGTATGGAACAATTC -3'
(R):5'- ATCATCCAGCCCGTATGTGAG -3'
Posted On2014-05-23