Incidental Mutation 'R1739:Dysf'
ID200175
Institutional Source Beutler Lab
Gene Symbol Dysf
Ensembl Gene ENSMUSG00000033788
Gene Namedysferlin
Synonyms2310004N10Rik
MMRRC Submission 039771-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1739 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location84008590-84211060 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 84112235 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081904] [ENSMUST00000089595] [ENSMUST00000113818] [ENSMUST00000113821] [ENSMUST00000113823] [ENSMUST00000153860] [ENSMUST00000168387] [ENSMUST00000203695] [ENSMUST00000203803] [ENSMUST00000204354] [ENSMUST00000204591] [ENSMUST00000204987]
Predicted Effect probably null
Transcript: ENSMUST00000081904
SMART Domains Protein: ENSMUSP00000080579
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 4.84e-14 SMART
FerI 337 408 5.3e-39 SMART
C2 414 528 2.96e-9 SMART
FerA 714 779 6.3e-23 SMART
FerB 806 880 2.49e-44 SMART
DysFN 894 953 1.42e-22 SMART
DysFN 966 1022 2.65e-22 SMART
DysFC 1031 1069 1.33e-13 SMART
DysFC 1088 1121 1.1e-10 SMART
C2 1173 1281 2.63e-15 SMART
C2 1350 1457 7.13e0 SMART
C2 1599 1698 2.52e-12 SMART
C2 1832 1961 1.55e-3 SMART
Pfam:Ferlin_C 1991 2095 6.7e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089595
SMART Domains Protein: ENSMUSP00000087022
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 1.12e-9 SMART
FerA 697 762 6.3e-23 SMART
FerB 789 863 2.49e-44 SMART
DysFN 877 936 1.42e-22 SMART
DysFN 949 1005 2.65e-22 SMART
DysFC 1014 1052 1.33e-13 SMART
DysFC 1071 1104 1.1e-10 SMART
C2 1156 1264 2.63e-15 SMART
C2 1333 1440 7.13e0 SMART
C2 1582 1681 2.52e-12 SMART
C2 1815 1944 1.55e-3 SMART
Pfam:Ferlin_C 1974 2078 3.7e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113818
SMART Domains Protein: ENSMUSP00000109449
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 101 2.11e-14 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 4.84e-14 SMART
FerI 306 377 5.3e-39 SMART
C2 383 497 2.96e-9 SMART
FerA 683 748 6.3e-23 SMART
FerB 775 849 2.49e-44 SMART
DysFN 863 922 1.42e-22 SMART
DysFN 935 991 2.65e-22 SMART
DysFC 1000 1038 1.33e-13 SMART
DysFC 1057 1090 1.1e-10 SMART
C2 1142 1250 2.63e-15 SMART
C2 1319 1426 7.13e0 SMART
C2 1568 1667 2.52e-12 SMART
C2 1801 1930 1.55e-3 SMART
transmembrane domain 2034 2056 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113821
SMART Domains Protein: ENSMUSP00000109452
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 696 761 6.3e-23 SMART
FerB 788 862 2.49e-44 SMART
DysFN 876 935 1.42e-22 SMART
DysFN 948 1004 2.65e-22 SMART
DysFC 1013 1051 1.33e-13 SMART
DysFC 1070 1103 1.1e-10 SMART
C2 1155 1263 2.63e-15 SMART
C2 1332 1439 7.13e0 SMART
C2 1581 1680 2.52e-12 SMART
C2 1814 1943 1.55e-3 SMART
transmembrane domain 2047 2069 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113823
SMART Domains Protein: ENSMUSP00000109454
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 4.84e-14 SMART
FerI 336 407 5.3e-39 SMART
C2 413 527 2.96e-9 SMART
FerA 713 778 6.3e-23 SMART
FerB 805 879 2.49e-44 SMART
DysFN 893 952 1.42e-22 SMART
DysFN 965 1021 2.65e-22 SMART
DysFC 1030 1068 1.33e-13 SMART
DysFC 1087 1120 1.1e-10 SMART
C2 1172 1280 2.63e-15 SMART
C2 1349 1456 7.13e0 SMART
C2 1598 1697 2.52e-12 SMART
C2 1831 1960 1.55e-3 SMART
transmembrane domain 2064 2086 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152646
Predicted Effect probably null
Transcript: ENSMUST00000153860
SMART Domains Protein: ENSMUSP00000145518
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 3.2e-16 SMART
FerI 305 376 2.6e-43 SMART
C2 382 496 7.4e-12 SMART
FerA 696 761 3.1e-27 SMART
FerB 788 862 1.2e-48 SMART
DysFN 876 935 5.3e-25 SMART
DysFN 948 1004 9.6e-25 SMART
DysFC 1013 1051 4.7e-16 SMART
DysFC 1070 1103 4.1e-13 SMART
C2 1155 1263 1.7e-17 SMART
C2 1332 1439 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168387
SMART Domains Protein: ENSMUSP00000132297
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 100 1.62e-15 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
C2 223 319 4.84e-14 SMART
FerI 305 376 5.3e-39 SMART
C2 382 496 1.12e-9 SMART
FerA 704 769 6.3e-23 SMART
FerB 796 870 2.49e-44 SMART
DysFN 884 943 1.42e-22 SMART
DysFN 956 1012 2.65e-22 SMART
DysFC 1021 1059 1.33e-13 SMART
DysFC 1078 1111 1.1e-10 SMART
C2 1163 1271 2.63e-15 SMART
C2 1340 1447 7.13e0 SMART
C2 1589 1688 2.52e-12 SMART
C2 1822 1951 1.55e-3 SMART
transmembrane domain 2055 2077 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203695
SMART Domains Protein: ENSMUSP00000145292
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 213 232 N/A INTRINSIC
C2 255 351 3.2e-16 SMART
FerI 337 408 2.6e-43 SMART
C2 414 528 7.4e-12 SMART
FerA 728 793 3.1e-27 SMART
FerB 820 894 1.2e-48 SMART
DysFN 908 967 5.3e-25 SMART
DysFN 980 1036 9.6e-25 SMART
DysFC 1045 1083 4.7e-16 SMART
DysFC 1102 1135 4.1e-13 SMART
C2 1187 1295 1.7e-17 SMART
C2 1364 1471 4.7e-2 SMART
C2 1613 1712 1.7e-14 SMART
C2 1846 1975 1.1e-5 SMART
Pfam:Ferlin_C 2005 2109 4.4e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203803
SMART Domains Protein: ENSMUSP00000145511
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 7.4e-12 SMART
FerA 727 792 3.1e-27 SMART
FerB 819 893 1.2e-48 SMART
DysFN 907 966 5.3e-25 SMART
DysFN 979 1035 9.6e-25 SMART
DysFC 1044 1082 4.7e-16 SMART
DysFC 1101 1134 4.1e-13 SMART
C2 1186 1294 1.7e-17 SMART
C2 1353 1460 4.7e-2 SMART
C2 1602 1701 1.7e-14 SMART
C2 1835 1964 1.1e-5 SMART
Pfam:Ferlin_C 1994 2098 4.4e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204354
SMART Domains Protein: ENSMUSP00000144705
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 2e-11 SMART
FerA 683 748 3.1e-27 SMART
FerB 775 849 1.2e-48 SMART
DysFN 863 922 5.3e-25 SMART
DysFN 935 991 9.6e-25 SMART
DysFC 1000 1038 4.7e-16 SMART
DysFC 1057 1090 4.1e-13 SMART
C2 1142 1250 1.7e-17 SMART
C2 1319 1426 4.7e-2 SMART
C2 1589 1688 1.7e-14 SMART
C2 1822 1951 1.1e-5 SMART
Pfam:Ferlin_C 1981 2085 4.4e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204591
SMART Domains Protein: ENSMUSP00000144970
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 100 1.1e-17 SMART
low complexity region 125 146 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
C2 254 350 3.2e-16 SMART
FerI 336 407 2.6e-43 SMART
C2 413 527 2e-11 SMART
FerA 713 778 3.1e-27 SMART
FerB 805 879 1.2e-48 SMART
DysFN 893 952 5.3e-25 SMART
DysFN 965 1021 9.6e-25 SMART
DysFC 1030 1068 4.7e-16 SMART
DysFC 1087 1120 4.1e-13 SMART
C2 1172 1280 1.7e-17 SMART
C2 1349 1456 4.7e-2 SMART
C2 1619 1718 1.7e-14 SMART
C2 1852 1981 1.1e-5 SMART
Pfam:Ferlin_C 2011 2115 4.4e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204987
SMART Domains Protein: ENSMUSP00000144748
Gene: ENSMUSG00000033788

DomainStartEndE-ValueType
C2 1 101 1.4e-16 SMART
low complexity region 126 147 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
C2 224 320 3.2e-16 SMART
FerI 306 377 2.6e-43 SMART
C2 383 497 7.4e-12 SMART
FerA 697 762 3.1e-27 SMART
FerB 789 863 1.2e-48 SMART
DysFN 877 936 5.3e-25 SMART
DysFN 949 1005 9.6e-25 SMART
DysFC 1014 1052 4.7e-16 SMART
DysFC 1071 1104 4.1e-13 SMART
C2 1156 1264 1.7e-17 SMART
C2 1333 1440 4.7e-2 SMART
C2 1603 1702 1.7e-14 SMART
C2 1836 1965 1.1e-5 SMART
Pfam:Ferlin_C 1995 2099 4.4e-22 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes display dystrophic muscle changes and progressive muscle weakness developing over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 231 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,278,306 T1059I probably benign Het
Abcb11 C T 2: 69,261,566 A871T probably damaging Het
Acot7 T C 4: 152,260,912 L313P probably damaging Het
Adam20 T A 8: 40,796,558 H568Q probably benign Het
Adam26b T A 8: 43,521,677 D96V probably damaging Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Apbb1 A G 7: 105,574,227 V59A probably benign Het
Apc A G 18: 34,312,318 K722E probably damaging Het
Aspm A G 1: 139,473,574 I1111V probably benign Het
Aspscr1 A G 11: 120,678,516 T47A probably damaging Het
Atr G A 9: 95,897,581 V1331I probably benign Het
Baz1a G A 12: 54,898,788 R1261* probably null Het
C2cd2l C A 9: 44,319,743 R49L probably benign Het
C4bp C G 1: 130,642,988 V284L probably benign Het
Cacna1c A C 6: 118,610,544 M1287R probably damaging Het
Cacna1s T C 1: 136,118,716 F1761S probably benign Het
Camsap2 C T 1: 136,281,315 R802Q probably benign Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc177 A G 12: 80,759,239 V87A probably damaging Het
Ccdc178 T A 18: 22,097,723 I364F possibly damaging Het
Ccdc93 C T 1: 121,456,126 P192L probably benign Het
Ccdc93 T C 1: 121,461,939 V237A probably benign Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cd55 C A 1: 130,459,633 A143S probably benign Het
Cdh19 C A 1: 110,893,384 E541D probably damaging Het
Cdh7 C G 1: 110,065,735 L307V possibly damaging Het
Cep120 A G 18: 53,719,214 probably null Het
Cep128 G T 12: 91,022,491 probably null Het
Cep131 T C 11: 120,083,906 I23V probably benign Het
Cfc1 A G 1: 34,537,234 D125G probably damaging Het
Cfh T C 1: 140,136,788 K374R probably benign Het
Cfh C T 1: 140,147,697 V268I possibly damaging Het
Cfhr2 A G 1: 139,813,442 M265T probably benign Het
Cfhr2 A C 1: 139,813,459 N259K probably benign Het
Chil1 C T 1: 134,188,529 A250V probably damaging Het
Clca1 C A 3: 145,007,778 M697I probably benign Het
Clec4a3 C T 6: 122,954,041 Q30* probably null Het
Cntnap3 T A 13: 64,740,592 R1232S probably benign Het
Cntnap5a C A 1: 116,455,004 L1001I probably benign Het
Cntnap5a T C 1: 116,455,101 L1033S probably benign Het
Cntnap5a C T 1: 116,455,143 T1047I probably benign Het
Col12a1 T A 9: 79,633,468 I2412F probably damaging Het
Crb1 T C 1: 139,234,779 M1214V probably benign Het
Crb1 A T 1: 139,237,622 H921Q probably benign Het
Crb1 G A 1: 139,241,138 P881S probably damaging Het
Crb1 C T 1: 139,242,995 G825R probably damaging Het
Crb1 C T 1: 139,243,417 R684H probably benign Het
Cxcl2 C T 5: 90,904,158 T41I probably damaging Het
Cxcr4 C T 1: 128,589,277 V216I probably benign Het
Cyb5r1 C T 1: 134,407,667 R147W probably damaging Het
Ddx59 T C 1: 136,417,053 V154A probably benign Het
Disp2 T C 2: 118,791,550 V921A probably damaging Het
Dnajc10 C G 2: 80,347,662 A671G probably benign Het
Dner T C 1: 84,370,784 I732V probably damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dsel G C 1: 111,859,994 T937S probably benign Het
Dstyk C T 1: 132,456,984 L739F probably damaging Het
Eefsec T A 6: 88,376,205 K161* probably null Het
Ehhadh G C 16: 21,762,253 A663G probably benign Het
En1 A G 1: 120,603,621 S197G unknown Het
Etnk2 A G 1: 133,363,923 S54G probably benign Het
Etnk2 C A 1: 133,365,587 D89E probably benign Het
Etnk2 G T 1: 133,365,765 G149W probably damaging Het
Etnk2 C T 1: 133,365,816 R166* probably null Het
Etnk2 G A 1: 133,365,817 R166Q probably benign Het
Etnk2 T A 1: 133,376,915 V292E probably benign Het
Exph5 T C 9: 53,375,588 V1323A possibly damaging Het
Eya2 G T 2: 165,687,663 G109W probably damaging Het
Fam72a T C 1: 131,530,668 I56T probably benign Het
Fam72a C T 1: 131,538,895 T139M probably benign Het
Fcamr A C 1: 130,804,627 N117T probably benign Het
Fcamr A G 1: 130,811,580 I206V probably benign Het
Fcamr G A 1: 130,812,629 G262S probably benign Het
Fcamr A G 1: 130,812,692 I283V probably benign Het
Fcamr T C 1: 130,812,738 V298A probably benign Het
Fcamr A G 1: 130,812,809 M322V probably benign Het
Fcamr C T 1: 130,812,816 P324L probably benign Het
Fcamr A G 1: 130,814,597 N574D probably benign Het
Fcmr A G 1: 130,875,974 T172A probably benign Het
Fcmr T C 1: 130,878,269 S321P probably benign Het
Focad T C 4: 88,397,891 M1560T probably benign Het
Gadd45gip1 T A 8: 84,832,292 M1K probably null Het
Gbgt1 T C 2: 28,505,052 V234A possibly damaging Het
Gin1 T A 1: 97,786,104 D376E probably damaging Het
Git1 A T 11: 77,498,982 I24F probably damaging Het
Gli2 C T 1: 118,868,087 A113T possibly damaging Het
Gli2 G T 1: 119,002,044 H44Q probably benign Het
Gm5152 T C 5: 10,245,204 I90V possibly damaging Het
Gnptab T C 10: 88,436,095 Y916H probably benign Het
Gpr25 G A 1: 136,260,710 P55L probably benign Het
Heg1 T G 16: 33,738,583 I1058S possibly damaging Het
Hivep3 A G 4: 120,095,174 Y229C probably benign Het
Idi1 T C 13: 8,890,411 F210L probably benign Het
Igfn1 G A 1: 135,959,928 P2466L probably damaging Het
Igfn1 G A 1: 135,968,199 A1543V probably benign Het
Igfn1 T C 1: 135,970,411 S806G probably benign Het
Igfn1 C T 1: 135,972,127 R482Q probably benign Het
Igfn1 C T 1: 135,979,915 A231T probably benign Het
Igfn1 G A 1: 135,982,475 R124W probably benign Het
Igfn1 T C 1: 135,998,625 E29G probably benign Het
Igfn1 T C 1: 135,998,683 I10V unknown Het
Ikbke C A 1: 131,265,937 A459S probably benign Het
Ikbke T C 1: 131,269,823 S447G probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kat7 T G 11: 95,276,547 I455L possibly damaging Het
Kcnh5 G T 12: 75,114,229 P302T probably damaging Het
Kcnt2 G A 1: 140,354,547 S90N probably benign Het
Kif14 A G 1: 136,468,279 N108D probably benign Het
Kif14 A G 1: 136,468,975 K340E probably damaging Het
Kif14 G A 1: 136,478,365 A556T probably benign Het
Kif14 A G 1: 136,490,332 S868G probably benign Het
Kif14 C T 1: 136,503,431 L1189F probably benign Het
Kif14 T C 1: 136,515,961 F1291L probably benign Het
Kif14 T C 1: 136,525,783 V1433A probably benign Het
Krtap12-1 C T 10: 77,720,992 T123I possibly damaging Het
Ksr1 G A 11: 79,047,305 T49I probably damaging Het
Lad1 C T 1: 135,827,381 P132S possibly damaging Het
Lad1 C T 1: 135,828,023 R346C probably damaging Het
Lat2 T C 5: 134,606,369 H89R possibly damaging Het
Lax1 T C 1: 133,679,978 R342G probably benign Het
Lax1 T C 1: 133,680,569 N145D probably benign Het
Lax1 G A 1: 133,683,634 P67S probably damaging Het
Lgr6 C T 1: 134,987,088 V641I probably benign Het
Lgr6 A T 1: 134,988,009 S334T probably benign Het
Lgr6 G T 1: 134,990,635 H263N probably benign Het
Lgr6 C T 1: 135,003,476 S3N probably benign Het
Lmod1 C T 1: 135,364,073 T222I probably benign Het
Man2a2 T C 7: 80,362,438 E657G probably benign Het
Mfsd4a C T 1: 132,067,883 D4N possibly damaging Het
Mn1 G T 5: 111,420,014 A617S possibly damaging Het
Mov10 T C 3: 104,800,282 D592G probably damaging Het
Mroh3 G C 1: 136,192,144 Q440E possibly damaging Het
Mtmr12 A T 15: 12,245,019 T207S probably benign Het
Musk G A 4: 58,293,563 V51M probably damaging Het
Mybph C T 1: 134,197,480 R249C probably benign Het
Naglu C T 11: 101,076,403 A393V possibly damaging Het
Nav1 A T 1: 135,584,727 D198E possibly damaging Het
Ncan T A 8: 70,108,086 T744S probably benign Het
Nlrp4c T A 7: 6,073,222 V707E probably damaging Het
Nr5a2 C A 1: 136,952,125 R35L probably benign Het
Nrcam A T 12: 44,571,675 Q822L probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1232 T A 2: 89,325,566 I205F probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Optc A T 1: 133,903,796 probably null Het
Optc C G 1: 133,905,170 S64T probably benign Het
Pak1 T A 7: 97,904,695 V424E probably damaging Het
Pdcd6 G A 13: 74,304,041 T160I probably damaging Het
Phf21a C T 2: 92,360,299 T535M possibly damaging Het
Pigr C T 1: 130,844,522 A159V possibly damaging Het
Pik3c2b C T 1: 133,066,627 P110S probably benign Het
Pkdrej G A 15: 85,820,427 T436I probably benign Het
Plekha6 C G 1: 133,287,846 T792S probably benign Het
Ppil2 C G 16: 17,089,419 probably benign Het
Ppip5k2 A T 1: 97,728,957 H830Q probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptpn7 A G 1: 135,134,475 Q53R probably benign Het
Ptprc T G 1: 138,099,676 N478T probably benign Het
Ptprc A G 1: 138,107,823 S405P probably benign Het
Ptprc C A 1: 138,107,824 E402D probably benign Het
Ptprc A G 1: 138,107,837 V400A probably benign Het
Ptprc T C 1: 138,112,254 K212E possibly damaging Het
Rab29 A G 1: 131,872,110 Q141R probably benign Het
Ren1 T A 1: 133,354,206 W22R probably damaging Het
Ren1 C T 1: 133,354,237 T32I probably benign Het
Ren1 A C 1: 133,356,457 K187Q probably benign Het
Ren1 A T 1: 133,359,079 E315D probably benign Het
Ren1 A T 1: 133,359,983 N352Y probably benign Het
Ren1 C G 1: 133,360,007 L360V probably benign Het
Rnpep C T 1: 135,263,096 A571T possibly damaging Het
Rnpep C G 1: 135,283,629 R127P probably benign Het
Sctr T C 1: 120,031,656 F110L probably benign Het
Sctr G T 1: 120,063,246 E453D probably benign Het
Sctr G A 1: 120,063,257 S440N possibly damaging Het
Sema4a A G 3: 88,436,838 L702P possibly damaging Het
Sept4 A T 11: 87,583,436 Q60L probably benign Het
Serpinb10 C T 1: 107,538,473 S63F probably damaging Het
Serpinb2 G A 1: 107,515,635 A55T probably damaging Het
Serpinb2 C A 1: 107,523,834 A239E probably benign Het
Serpinb2 C T 1: 107,523,890 H258Y probably benign Het
Serpinb2 C T 1: 107,523,894 T259I probably benign Het
Serpinb2 A C 1: 107,524,543 S284R probably benign Het
Serpinb8 A G 1: 107,597,527 S20G probably benign Het
Serpinb8 G A 1: 107,598,954 A75T probably benign Het
Serpinb8 A C 1: 107,607,004 L268F probably benign Het
Shank2 A T 7: 144,179,853 N482Y probably damaging Het
Shc3 A T 13: 51,482,916 V72E probably damaging Het
Slc26a9 C T 1: 131,763,870 A617V probably benign Het
Slc45a4 A G 15: 73,586,038 I562T probably damaging Het
Smc6 T G 12: 11,317,853 V1088G probably benign Het
Snx32 C A 19: 5,496,111 R341L probably benign Het
Specc1 C T 11: 62,118,818 Q467* probably null Het
Spock3 A T 8: 63,348,947 N323I probably damaging Het
Stac3 A G 10: 127,507,766 K259R probably benign Het
Steap3 T C 1: 120,227,750 N493S probably benign Het
Steap3 G A 1: 120,234,378 A350V probably benign Het
Stx3 A G 19: 11,785,523 I163T probably damaging Het
Suco A G 1: 161,827,655 probably null Het
Syngr4 A G 7: 45,888,722 F74S possibly damaging Het
Synpo2l G A 14: 20,665,819 P233S probably damaging Het
Tcf4 A T 18: 69,642,970 T163S probably damaging Het
Thsd7b C T 1: 129,628,891 T328I probably damaging Het
Thsd7b T A 1: 129,667,937 F498Y probably benign Het
Thsd7b G C 1: 129,678,183 A554P probably benign Het
Thsd7b A C 1: 130,116,631 Q1116P probably benign Het
Tlk1 T C 2: 70,721,077 Y634C probably damaging Het
Tnnt2 C T 1: 135,845,506 probably benign Het
Tox2 T C 2: 163,247,785 Y66H probably damaging Het
Trove2 C T 1: 143,760,014 V465I probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ttyh1 G A 7: 4,129,349 M261I probably benign Het
Ubap2 A G 4: 41,206,849 V509A probably benign Het
Ube2t C T 1: 134,972,167 A149V probably benign Het
Ucp3 G C 7: 100,482,720 M259I probably benign Het
Unc80 A T 1: 66,527,892 N886Y probably damaging Het
Vmn1r197 T A 13: 22,328,371 L154Q possibly damaging Het
Vmn1r40 T A 6: 89,714,315 M38K probably benign Het
Vmn2r78 C A 7: 86,920,789 Q172K probably benign Het
Zc3h11a G A 1: 133,622,154 P695S probably benign Het
Zc3h11a C T 1: 133,624,621 V583I probably benign Het
Zfhx4 A T 3: 5,401,730 D2316V probably damaging Het
Zfp108 T C 7: 24,261,310 V442A probably damaging Het
Zfp260 A T 7: 30,104,806 T44S probably benign Het
Zfp873 C A 10: 82,060,707 T424N probably damaging Het
Zp3r A G 1: 130,596,814 L164P probably benign Het
Zp3r C A 1: 130,619,414 E8D possibly damaging Het
Zswim2 T A 2: 83,915,340 K585* probably null Het
Other mutations in Dysf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Dysf APN 6 84108099 missense probably damaging 1.00
IGL00340:Dysf APN 6 84141951 missense probably benign 0.02
IGL00429:Dysf APN 6 84189844 missense probably damaging 1.00
IGL00465:Dysf APN 6 84199848 critical splice donor site probably null
IGL00800:Dysf APN 6 84149998 missense probably damaging 1.00
IGL01069:Dysf APN 6 84199785 missense possibly damaging 0.94
IGL01094:Dysf APN 6 84194386 missense probably damaging 1.00
IGL01420:Dysf APN 6 84149759 nonsense probably null
IGL01649:Dysf APN 6 84199839 missense probably damaging 1.00
IGL01923:Dysf APN 6 84210829 makesense probably null
IGL01991:Dysf APN 6 84113618 missense probably damaging 1.00
IGL01999:Dysf APN 6 84113618 missense probably damaging 1.00
IGL02002:Dysf APN 6 84210787 splice site probably benign
IGL02136:Dysf APN 6 84108167 missense probably benign 0.43
IGL02318:Dysf APN 6 84186464 missense possibly damaging 0.50
IGL02378:Dysf APN 6 84111905 missense probably damaging 1.00
IGL02404:Dysf APN 6 84116061 missense probably damaging 1.00
IGL02416:Dysf APN 6 84192914 missense possibly damaging 0.92
IGL02535:Dysf APN 6 84149697 missense possibly damaging 0.45
IGL02553:Dysf APN 6 84130127 missense possibly damaging 0.95
IGL02559:Dysf APN 6 84067446 splice site probably benign
IGL02563:Dysf APN 6 84186516 splice site probably benign
IGL02647:Dysf APN 6 84137373 missense probably damaging 1.00
IGL02820:Dysf APN 6 84100205 missense probably damaging 0.99
IGL02858:Dysf APN 6 84099489 missense probably benign 0.01
IGL02860:Dysf APN 6 84190898 critical splice donor site probably null
IGL02861:Dysf APN 6 84039537 missense probably damaging 0.99
IGL03008:Dysf APN 6 84073894 missense probably benign 0.01
IGL03023:Dysf APN 6 84193007 missense probably damaging 1.00
IGL03074:Dysf APN 6 84188226 missense probably benign 0.25
IGL03342:Dysf APN 6 84190872 missense probably benign
R0067:Dysf UTSW 6 84063331 missense possibly damaging 0.58
R0106:Dysf UTSW 6 84113336 missense probably benign 0.07
R0106:Dysf UTSW 6 84113336 missense probably benign 0.07
R0124:Dysf UTSW 6 84065102 splice site probably benign
R0219:Dysf UTSW 6 84129461 splice site probably benign
R0238:Dysf UTSW 6 84064479 nonsense probably null
R0238:Dysf UTSW 6 84064479 nonsense probably null
R0239:Dysf UTSW 6 84064479 nonsense probably null
R0239:Dysf UTSW 6 84064479 nonsense probably null
R0426:Dysf UTSW 6 84149757 missense probably damaging 1.00
R0455:Dysf UTSW 6 84140667 missense probably benign 0.29
R0482:Dysf UTSW 6 84152405 missense probably benign 0.03
R0545:Dysf UTSW 6 84099461 missense probably damaging 0.99
R0625:Dysf UTSW 6 84111987 splice site probably null
R0676:Dysf UTSW 6 84113336 missense probably benign 0.07
R0699:Dysf UTSW 6 84190846 missense probably benign 0.00
R1165:Dysf UTSW 6 84067069 missense probably damaging 0.98
R1455:Dysf UTSW 6 84113386 missense probably benign 0.01
R1582:Dysf UTSW 6 84097767 missense probably damaging 1.00
R1584:Dysf UTSW 6 84067047 missense probably benign 0.04
R1605:Dysf UTSW 6 84106941 missense probably damaging 0.96
R1674:Dysf UTSW 6 84179715 missense probably benign 0.01
R1765:Dysf UTSW 6 84190902 splice site probably null
R1813:Dysf UTSW 6 84151924 missense possibly damaging 0.83
R1900:Dysf UTSW 6 84039567 missense probably damaging 0.97
R1960:Dysf UTSW 6 84073903 missense probably benign 0.12
R2216:Dysf UTSW 6 84207245 splice site probably null
R2242:Dysf UTSW 6 84186509 critical splice donor site probably null
R2243:Dysf UTSW 6 84186509 critical splice donor site probably null
R2245:Dysf UTSW 6 84186509 critical splice donor site probably null
R2246:Dysf UTSW 6 84186509 critical splice donor site probably null
R2280:Dysf UTSW 6 84064494 missense probably damaging 0.99
R2374:Dysf UTSW 6 84097729 missense probably damaging 1.00
R2403:Dysf UTSW 6 84039567 missense possibly damaging 0.84
R2763:Dysf UTSW 6 84106932 missense probably benign 0.00
R2895:Dysf UTSW 6 84186509 critical splice donor site probably null
R2916:Dysf UTSW 6 84186509 critical splice donor site probably null
R2918:Dysf UTSW 6 84186509 critical splice donor site probably null
R3402:Dysf UTSW 6 84186509 critical splice donor site probably null
R3403:Dysf UTSW 6 84186509 critical splice donor site probably null
R3434:Dysf UTSW 6 84070888 missense probably benign 0.00
R3772:Dysf UTSW 6 84152351 missense possibly damaging 0.63
R3781:Dysf UTSW 6 84186509 critical splice donor site probably null
R3789:Dysf UTSW 6 84186509 critical splice donor site probably null
R3822:Dysf UTSW 6 84207088 splice site probably benign
R3918:Dysf UTSW 6 84186509 critical splice donor site probably null
R3919:Dysf UTSW 6 84186509 critical splice donor site probably null
R3939:Dysf UTSW 6 84186509 critical splice donor site probably null
R3942:Dysf UTSW 6 84186509 critical splice donor site probably null
R4177:Dysf UTSW 6 84067031 nonsense probably null
R4179:Dysf UTSW 6 84186509 critical splice donor site probably null
R4180:Dysf UTSW 6 84186509 critical splice donor site probably null
R4299:Dysf UTSW 6 84068077 missense possibly damaging 0.78
R4419:Dysf UTSW 6 84207242 critical splice donor site probably null
R4446:Dysf UTSW 6 84205872 missense probably damaging 1.00
R4577:Dysf UTSW 6 84137326 missense probably damaging 1.00
R4680:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4708:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4709:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4710:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4725:Dysf UTSW 6 84097756 missense probably damaging 1.00
R4742:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4743:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4749:Dysf UTSW 6 84067008 missense probably damaging 1.00
R4787:Dysf UTSW 6 84203328 nonsense probably null
R4850:Dysf UTSW 6 84097715 missense probably damaging 0.99
R4868:Dysf UTSW 6 84179693 missense probably damaging 1.00
R4871:Dysf UTSW 6 84067023 missense possibly damaging 0.93
R4951:Dysf UTSW 6 84114120 critical splice donor site probably null
R4952:Dysf UTSW 6 84149986 missense possibly damaging 0.79
R5009:Dysf UTSW 6 84151986 missense probably damaging 1.00
R5072:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5073:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5074:Dysf UTSW 6 84137272 missense probably damaging 1.00
R5252:Dysf UTSW 6 84186468 missense probably damaging 0.98
R5260:Dysf UTSW 6 84150034 missense probably damaging 1.00
R5447:Dysf UTSW 6 84195263 missense probably damaging 0.98
R5501:Dysf UTSW 6 84087818 missense probably damaging 0.99
R5533:Dysf UTSW 6 84186471 missense probably damaging 0.99
R5611:Dysf UTSW 6 84064878 missense probably damaging 0.98
R5618:Dysf UTSW 6 84106824 missense probably benign 0.03
R5884:Dysf UTSW 6 84186081 missense probably damaging 1.00
R5927:Dysf UTSW 6 84207212 missense probably damaging 1.00
R6045:Dysf UTSW 6 84114072 missense probably damaging 0.99
R6056:Dysf UTSW 6 84106862 missense probably benign
R6084:Dysf UTSW 6 84019604 missense probably damaging 0.98
R6084:Dysf UTSW 6 84112119 missense probably damaging 1.00
R6146:Dysf UTSW 6 84203199 missense probably damaging 0.96
R6220:Dysf UTSW 6 84149745 missense probably damaging 0.97
R6232:Dysf UTSW 6 84098253 missense probably benign 0.26
R6247:Dysf UTSW 6 84066999 missense probably damaging 1.00
R6298:Dysf UTSW 6 84107136 intron probably null
R6306:Dysf UTSW 6 84137266 missense possibly damaging 0.91
R6377:Dysf UTSW 6 84008963 missense probably benign
R6415:Dysf UTSW 6 84140042 missense probably damaging 1.00
R6444:Dysf UTSW 6 84190840 missense probably benign 0.36
R6470:Dysf UTSW 6 84066944 missense possibly damaging 0.93
R6504:Dysf UTSW 6 84008925 missense probably benign 0.03
R6557:Dysf UTSW 6 84186384 missense probably damaging 0.99
R6665:Dysf UTSW 6 84130116 missense probably benign
R6701:Dysf UTSW 6 84112190 missense probably damaging 1.00
R6776:Dysf UTSW 6 84064894 missense possibly damaging 0.88
R6909:Dysf UTSW 6 84192938 missense probably damaging 1.00
R7007:Dysf UTSW 6 84113980 missense probably damaging 1.00
R7013:Dysf UTSW 6 84137358 missense probably damaging 1.00
R7035:Dysf UTSW 6 84186392 missense probably benign 0.02
R7094:Dysf UTSW 6 84100202 missense not run
X0063:Dysf UTSW 6 84063354 missense probably damaging 0.97
X0066:Dysf UTSW 6 84114102 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGCTCTCTGTCTTTGCCGAAACG -3'
(R):5'- AGTGAGCTATTCCTGCTAAGCCCC -3'

Sequencing Primer
(F):5'- TGAAGATGTATGACCCTTCACC -3'
(R):5'- CCAGCCCCATGAGGGTC -3'
Posted On2014-05-23