Incidental Mutation 'R1816:Klf4'
ID204406
Institutional Source Beutler Lab
Gene Symbol Klf4
Ensembl Gene ENSMUSG00000003032
Gene NameKruppel-like factor 4 (gut)
SynonymsZie, EZF, Gklf
MMRRC Submission 039844-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1816 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location55527143-55532466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55530977 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 45 (R45S)
Ref Sequence ENSEMBL: ENSMUSP00000103245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107619] [ENSMUST00000129250] [ENSMUST00000132746]
PDB Structure
CRYSTAL STRUCTURE OF THE ZINC FINGER DOMAIN OF KLF4 BOUND TO ITS TARGET DNA [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ZINC FINGER DOMAIN OF KLF4 BOUND TO ITS TARGET DNA [X-RAY DIFFRACTION]
Structure of Klf4 zinc finger DNA binding domain in complex with methylated DNA [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000107619
AA Change: R45S

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103245
Gene: ENSMUSG00000003032
AA Change: R45S

DomainStartEndE-ValueType
low complexity region 116 144 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 235 252 N/A INTRINSIC
low complexity region 335 357 N/A INTRINSIC
ZnF_C2H2 400 424 1.82e-3 SMART
ZnF_C2H2 430 454 4.3e-5 SMART
ZnF_C2H2 460 482 8.47e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129250
AA Change: R36S

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116514
Gene: ENSMUSG00000003032
AA Change: R36S

DomainStartEndE-ValueType
low complexity region 107 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132746
SMART Domains Protein: ENSMUSP00000123687
Gene: ENSMUSG00000003032

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Kruppel family of transcription factors. The encoded zinc finger protein is required for normal development of the barrier function of skin. The encoded protein is thought to control the G1-to-S transition of the cell cycle following DNA damage by mediating the tumor suppressor gene p53. Mice lacking this gene have a normal appearance but lose weight rapidly, and die shortly after birth due to fluid evaporation resulting from compromised epidermal barrier function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations die shortly after birth due to a skin defect that results in loss of fluids. Mutants also show a dramatic decrease in the number of goblet cells of the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,994,798 Y721* probably null Het
4933405L10Rik T A 8: 105,709,859 V220E possibly damaging Het
4933434E20Rik T C 3: 90,053,091 V13A possibly damaging Het
Adam1b T G 5: 121,501,725 Q419P probably damaging Het
Ankib1 A G 5: 3,734,028 V316A probably benign Het
Anks1 T A 17: 27,986,573 D294E probably damaging Het
Atr T C 9: 95,866,694 S431P probably benign Het
BC005561 A G 5: 104,517,834 D74G probably benign Het
BC037034 A G 5: 138,260,341 V548A possibly damaging Het
Bfsp1 C T 2: 143,841,679 A242T probably benign Het
Bptf A T 11: 107,060,579 V279E probably damaging Het
Camkk2 A G 5: 122,734,180 L540P probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam12 T A 7: 18,071,765 probably null Het
Cntnap5a G T 1: 116,428,888 A823S probably benign Het
Cp T C 3: 19,968,220 probably benign Het
Dhx58 A G 11: 100,703,152 V163A probably damaging Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Disp1 T A 1: 183,098,575 D288V probably damaging Het
Dnah7a A G 1: 53,631,742 probably benign Het
Eaf2 T G 16: 36,808,009 probably benign Het
Efna1 T C 3: 89,276,387 N44S possibly damaging Het
Etnppl T C 3: 130,634,562 I462T probably benign Het
Fam83d G T 2: 158,768,150 A13S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Fstl1 A G 16: 37,826,724 probably null Het
Gm14226 A T 2: 155,025,629 D502V probably damaging Het
Gm5117 T A 8: 31,738,958 noncoding transcript Het
Gm973 A G 1: 59,582,399 N566S probably damaging Het
Grm7 A T 6: 111,495,791 K16* probably null Het
Hbb-bh2 G A 7: 103,840,378 T17I possibly damaging Het
Htt C T 5: 34,803,740 A237V probably benign Het
Itga6 T C 2: 71,840,809 V665A probably benign Het
Mki67 T C 7: 135,707,387 D445G possibly damaging Het
Myo10 T C 15: 25,800,200 V1454A probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Odam A G 5: 87,889,470 probably null Het
Olfr1080 A T 2: 86,553,667 C152* probably null Het
Olfr1179 T G 2: 88,402,599 I112L possibly damaging Het
Olfr393 T C 11: 73,847,199 K309E probably benign Het
Olfr508 T C 7: 108,630,157 L55P probably damaging Het
Olfr695 A T 7: 106,873,488 Y252* probably null Het
Olfr998 G T 2: 85,590,925 K128N probably benign Het
Pcm1 T A 8: 41,309,537 S1412T probably damaging Het
Pgap1 A G 1: 54,492,057 L753P probably damaging Het
Pi4k2b T C 5: 52,750,746 S153P probably damaging Het
Pik3c2b C T 1: 133,101,370 A1398V probably benign Het
Pkhd1l1 T C 15: 44,528,239 I1567T possibly damaging Het
Rapgef6 G A 11: 54,694,488 V1571I probably benign Het
Rfx2 C A 17: 56,808,305 E5* probably null Het
Sh3tc1 C A 5: 35,700,584 probably null Het
Slc22a12 G A 19: 6,542,653 Q20* probably null Het
Slc4a1 A G 11: 102,351,230 C861R probably damaging Het
Snrnp25 G A 11: 32,207,565 V48I probably damaging Het
Spata1 G T 3: 146,481,207 P211Q probably damaging Het
Srgap1 G A 10: 121,925,971 Q91* probably null Het
Stab1 T C 14: 31,157,465 D686G probably benign Het
Stx8 T A 11: 68,011,326 M112K possibly damaging Het
Tfap2b A T 1: 19,209,212 K15N probably damaging Het
Thbs2 C A 17: 14,670,713 D1052Y probably benign Het
Thbs2 T A 17: 14,670,714 E1051D probably benign Het
Tlr2 T C 3: 83,838,209 Y189C probably damaging Het
Tmem268 C A 4: 63,565,710 P55T possibly damaging Het
Tnpo3 T C 6: 29,557,017 H745R probably benign Het
Ube2s T C 7: 4,811,555 N2S probably damaging Het
Ulk1 A G 5: 110,787,831 Y39H probably damaging Het
Vmn1r49 G T 6: 90,072,803 D72E possibly damaging Het
Vmn2r27 C A 6: 124,230,371 G104* probably null Het
Vmn2r92 A G 17: 18,166,677 I93V probably damaging Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zfp958 A T 8: 4,629,147 I391F possibly damaging Het
Other mutations in Klf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Klf4 APN 4 55530949 missense probably benign 0.14
IGL02602:Klf4 APN 4 55530595 missense probably damaging 0.99
IGL03088:Klf4 APN 4 55530758 missense possibly damaging 0.52
IGL03088:Klf4 APN 4 55530811 missense probably damaging 1.00
IGL03185:Klf4 APN 4 55530911 missense possibly damaging 0.65
R0846:Klf4 UTSW 4 55530191 missense probably damaging 0.99
R1815:Klf4 UTSW 4 55530977 missense probably benign 0.24
R4180:Klf4 UTSW 4 55530884 missense possibly damaging 0.96
R4625:Klf4 UTSW 4 55530370 missense probably benign 0.39
R4993:Klf4 UTSW 4 55530640 missense probably damaging 1.00
R5021:Klf4 UTSW 4 55530970 missense probably damaging 1.00
R5033:Klf4 UTSW 4 55530301 missense probably benign 0.23
R5113:Klf4 UTSW 4 55530481 missense possibly damaging 0.94
R6569:Klf4 UTSW 4 55530394 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAAAGTCTAGGTCCAGGAGGTC -3'
(R):5'- GCACTAGCTTGCAGGAGAAC -3'

Sequencing Primer
(F):5'- TCCAGGAGGTCGTTGAACTC -3'
(R):5'- ACCTCTTACCTTGGTGTTAGCTGAG -3'
Posted On2014-06-23