Incidental Mutation 'R1816:Gm5117'
ID204429
Institutional Source Beutler Lab
Gene Symbol Gm5117
Ensembl Gene ENSMUSG00000093862
Gene Namepredicted gene 5117
Synonyms
MMRRC Submission 039844-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R1816 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location31737208-31739760 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to A at 31738958 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178878
SMART Domains Protein: ENSMUSP00000137046
Gene: ENSMUSG00000093862

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
low complexity region 608 627 N/A INTRINSIC
Pfam:Met_10 666 799 1.5e-9 PFAM
Pfam:UPF0020 672 770 4e-8 PFAM
Pfam:Methyltransf_18 687 815 5e-10 PFAM
Pfam:Methyltransf_31 688 801 1.5e-10 PFAM
Pfam:Methyltransf_26 688 803 1e-8 PFAM
Pfam:Methyltransf_15 688 842 5e-48 PFAM
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.9%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,994,798 Y721* probably null Het
4933405L10Rik T A 8: 105,709,859 V220E possibly damaging Het
4933434E20Rik T C 3: 90,053,091 V13A possibly damaging Het
Adam1b T G 5: 121,501,725 Q419P probably damaging Het
Ankib1 A G 5: 3,734,028 V316A probably benign Het
Anks1 T A 17: 27,986,573 D294E probably damaging Het
Atr T C 9: 95,866,694 S431P probably benign Het
BC005561 A G 5: 104,517,834 D74G probably benign Het
BC037034 A G 5: 138,260,341 V548A possibly damaging Het
Bfsp1 C T 2: 143,841,679 A242T probably benign Het
Bptf A T 11: 107,060,579 V279E probably damaging Het
Camkk2 A G 5: 122,734,180 L540P probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam12 T A 7: 18,071,765 probably null Het
Cntnap5a G T 1: 116,428,888 A823S probably benign Het
Cp T C 3: 19,968,220 probably benign Het
Dhx58 A G 11: 100,703,152 V163A probably damaging Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Disp1 T A 1: 183,098,575 D288V probably damaging Het
Dnah7a A G 1: 53,631,742 probably benign Het
Eaf2 T G 16: 36,808,009 probably benign Het
Efna1 T C 3: 89,276,387 N44S possibly damaging Het
Etnppl T C 3: 130,634,562 I462T probably benign Het
Fam83d G T 2: 158,768,150 A13S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Fstl1 A G 16: 37,826,724 probably null Het
Gm14226 A T 2: 155,025,629 D502V probably damaging Het
Gm973 A G 1: 59,582,399 N566S probably damaging Het
Grm7 A T 6: 111,495,791 K16* probably null Het
Hbb-bh2 G A 7: 103,840,378 T17I possibly damaging Het
Htt C T 5: 34,803,740 A237V probably benign Het
Itga6 T C 2: 71,840,809 V665A probably benign Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Mki67 T C 7: 135,707,387 D445G possibly damaging Het
Myo10 T C 15: 25,800,200 V1454A probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Odam A G 5: 87,889,470 probably null Het
Olfr1080 A T 2: 86,553,667 C152* probably null Het
Olfr1179 T G 2: 88,402,599 I112L possibly damaging Het
Olfr393 T C 11: 73,847,199 K309E probably benign Het
Olfr508 T C 7: 108,630,157 L55P probably damaging Het
Olfr695 A T 7: 106,873,488 Y252* probably null Het
Olfr998 G T 2: 85,590,925 K128N probably benign Het
Pcm1 T A 8: 41,309,537 S1412T probably damaging Het
Pgap1 A G 1: 54,492,057 L753P probably damaging Het
Pi4k2b T C 5: 52,750,746 S153P probably damaging Het
Pik3c2b C T 1: 133,101,370 A1398V probably benign Het
Pkhd1l1 T C 15: 44,528,239 I1567T possibly damaging Het
Rapgef6 G A 11: 54,694,488 V1571I probably benign Het
Rfx2 C A 17: 56,808,305 E5* probably null Het
Sh3tc1 C A 5: 35,700,584 probably null Het
Slc22a12 G A 19: 6,542,653 Q20* probably null Het
Slc4a1 A G 11: 102,351,230 C861R probably damaging Het
Snrnp25 G A 11: 32,207,565 V48I probably damaging Het
Spata1 G T 3: 146,481,207 P211Q probably damaging Het
Srgap1 G A 10: 121,925,971 Q91* probably null Het
Stab1 T C 14: 31,157,465 D686G probably benign Het
Stx8 T A 11: 68,011,326 M112K possibly damaging Het
Tfap2b A T 1: 19,209,212 K15N probably damaging Het
Thbs2 C A 17: 14,670,713 D1052Y probably benign Het
Thbs2 T A 17: 14,670,714 E1051D probably benign Het
Tlr2 T C 3: 83,838,209 Y189C probably damaging Het
Tmem268 C A 4: 63,565,710 P55T possibly damaging Het
Tnpo3 T C 6: 29,557,017 H745R probably benign Het
Ube2s T C 7: 4,811,555 N2S probably damaging Het
Ulk1 A G 5: 110,787,831 Y39H probably damaging Het
Vmn1r49 G T 6: 90,072,803 D72E possibly damaging Het
Vmn2r27 C A 6: 124,230,371 G104* probably null Het
Vmn2r92 A G 17: 18,166,677 I93V probably damaging Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zfp958 A T 8: 4,629,147 I391F possibly damaging Het
Other mutations in Gm5117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Gm5117 APN 8 31738487 exon noncoding transcript
IGL01362:Gm5117 APN 8 31737919 exon noncoding transcript
IGL01972:Gm5117 APN 8 31737759 exon noncoding transcript
IGL02100:Gm5117 APN 8 31737384 exon noncoding transcript
IGL02339:Gm5117 APN 8 31738226 exon noncoding transcript
IGL02366:Gm5117 APN 8 31737859 exon noncoding transcript
IGL02505:Gm5117 APN 8 31738316 exon noncoding transcript
IGL02698:Gm5117 APN 8 31739739 exon noncoding transcript
IGL03310:Gm5117 APN 8 31738808 exon noncoding transcript
IGL02835:Gm5117 UTSW 8 31737170 unclassified noncoding transcript
R2157:Gm5117 UTSW 8 31738194 exon noncoding transcript
R2353:Gm5117 UTSW 8 31739195 exon noncoding transcript
R2404:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2408:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2409:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2510:Gm5117 UTSW 8 31738355 exon noncoding transcript
R4686:Gm5117 UTSW 8 31739256 exon noncoding transcript
R4953:Gm5117 UTSW 8 31738580 exon noncoding transcript
R5244:Gm5117 UTSW 8 31738277 exon noncoding transcript
R5275:Gm5117 UTSW 8 31739567 exon noncoding transcript
R5329:Gm5117 UTSW 8 31737882 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATTTCACTGAGCGGCTCATC -3'
(R):5'- GCAGGAGAAGTATCCAGACC -3'

Sequencing Primer
(F):5'- GAGGAATCTAACTGGCTCTGTTCTAC -3'
(R):5'- CAGACCAGACACTGTCTTCTG -3'
Posted On2014-06-23