Incidental Mutation 'R1838:Chd8'
ID205539
Institutional Source Beutler Lab
Gene Symbol Chd8
Ensembl Gene ENSMUSG00000053754
Gene Namechromodomain helicase DNA binding protein 8
SynonymsDuplin, 5830451P18Rik
MMRRC Submission 039865-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1838 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location52198151-52257780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52204883 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 2077 (S2077G)
Ref Sequence ENSEMBL: ENSMUSP00000142890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000227897]
Predicted Effect probably benign
Transcript: ENSMUST00000089752
AA Change: S2077G

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: S2077G

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147827
Predicted Effect probably benign
Transcript: ENSMUST00000149975
AA Change: S737G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: S737G

DomainStartEndE-ValueType
low complexity region 74 93 N/A INTRINSIC
Blast:DEXDc 112 235 9e-40 BLAST
low complexity region 239 250 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
low complexity region 430 445 N/A INTRINSIC
Blast:SANT 456 515 1e-29 BLAST
low complexity region 547 563 N/A INTRINSIC
low complexity region 723 767 N/A INTRINSIC
low complexity region 882 899 N/A INTRINSIC
BRK 972 1016 1.34e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180857
Predicted Effect probably benign
Transcript: ENSMUST00000200169
AA Change: S2077G

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: S2077G

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227448
Predicted Effect probably benign
Transcript: ENSMUST00000227897
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T C 6: 132,626,727 D22G unknown Het
Abca4 G A 3: 122,128,305 R1170K probably benign Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adamtsl3 G T 7: 82,493,373 R267L probably damaging Het
Adgrb2 A T 4: 130,010,231 T717S probably benign Het
Adgrb3 A G 1: 25,084,270 S1417P probably damaging Het
Afg3l2 A T 18: 67,414,172 V561D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Btnl6 T A 17: 34,515,542 D82V probably damaging Het
Ccdc178 A G 18: 22,067,638 Y421H probably damaging Het
Cdc123 A T 2: 5,794,891 probably null Het
Cdhr5 C T 7: 141,272,603 V367I possibly damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Ctnna2 T C 6: 77,845,542 D26G probably damaging Het
Ctr9 G T 7: 111,052,303 R910L possibly damaging Het
Cyp2t4 G T 7: 27,158,416 R455L possibly damaging Het
Cyp3a13 A T 5: 137,911,632 probably null Het
Dennd3 T C 15: 73,565,100 S1059P probably damaging Het
Dennd4c A G 4: 86,825,178 T1135A probably benign Het
Dnah7b T C 1: 46,116,177 V295A probably benign Het
Dnah7b C A 1: 46,277,105 T3126K probably damaging Het
Ehbp1l1 C T 19: 5,717,691 E1195K probably benign Het
Exoc6b T A 6: 84,853,678 I447L probably benign Het
Glt1d1 G A 5: 127,678,129 V202I probably benign Het
Grk1 T C 8: 13,416,155 V533A possibly damaging Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Gzma T A 13: 113,095,984 I131F probably damaging Het
Helq A T 5: 100,771,879 L35* probably null Het
Hnrnpll T C 17: 80,038,623 N403S probably damaging Het
Hsf5 A G 11: 87,636,055 K518E probably benign Het
Ighe T A 12: 113,271,850 H258L unknown Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Ints13 C T 6: 146,566,611 A129T possibly damaging Het
Ipo7 T A 7: 110,042,109 H345Q probably damaging Het
Kcna2 A T 3: 107,104,512 E136D probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krtap4-9 A G 11: 99,785,396 probably benign Het
Lamc3 T C 2: 31,925,582 S1097P possibly damaging Het
Ldlrad2 A T 4: 137,572,170 N114K probably benign Het
Lrfn1 A T 7: 28,459,768 I371L probably damaging Het
Lrwd1 A G 5: 136,132,388 V240A probably benign Het
Lypd1 A T 1: 125,873,371 probably benign Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Man2c1 A G 9: 57,137,337 N354S probably benign Het
Map3k13 T C 16: 21,914,189 Y514H possibly damaging Het
Med15 T C 16: 17,653,562 D577G probably benign Het
Mroh4 A T 15: 74,616,113 M320K probably benign Het
Ms4a10 T A 19: 10,964,047 D186V possibly damaging Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Myo5c A T 9: 75,273,553 R741S probably damaging Het
Naip6 T C 13: 100,316,136 D139G probably damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Olfr1252 A T 2: 89,721,709 M134K probably damaging Het
Olfr1370 A T 13: 21,072,425 L292* probably null Het
Olfr229 A T 9: 39,909,841 I13F possibly damaging Het
Olfr982 A T 9: 40,074,309 M5L probably benign Het
Pcdhb3 A G 18: 37,301,317 D112G probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Pgm3 C T 9: 86,569,233 V123I probably benign Het
Pms1 A C 1: 53,192,098 probably null Het
Prl2b1 A G 13: 27,388,566 S14P possibly damaging Het
Prune2 T A 19: 17,199,878 W212R probably damaging Het
Rabgef1 A G 5: 130,213,021 E422G probably benign Het
Ralyl A G 3: 14,143,412 E204G probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rbpms2 TGCCGCCGCC TGCCGCCGCCGCC 9: 65,651,680 probably benign Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Slc16a7 C T 10: 125,231,198 V191M probably damaging Het
Slc34a2 A T 5: 53,058,436 H63L probably benign Het
Smpd4 G A 16: 17,642,302 probably null Het
Sp3 A G 2: 72,938,176 S748P possibly damaging Het
Spata31d1b G A 13: 59,715,857 C273Y probably benign Het
Spata31d1b G A 13: 59,717,465 R809K probably benign Het
Tmco5 A T 2: 116,880,879 E90V probably damaging Het
Tnxb A T 17: 34,678,910 D844V probably damaging Het
Tpi1 T C 6: 124,814,152 T41A probably benign Het
Ttn T C 2: 76,727,192 I29853V probably damaging Het
Vmn2r26 C T 6: 124,024,771 T5I probably benign Het
Wdr95 A G 5: 149,599,366 D663G probably benign Het
Zbtb39 T C 10: 127,742,700 F381S probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp646 T A 7: 127,879,739 Y363N probably damaging Het
Zfp712 A C 13: 67,042,047 C139G probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Chd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Chd8 APN 14 52226138 missense probably damaging 0.99
IGL00694:Chd8 APN 14 52217970 missense probably damaging 1.00
IGL01011:Chd8 APN 14 52231532 missense possibly damaging 0.86
IGL01022:Chd8 APN 14 52236993 missense probably benign
IGL01066:Chd8 APN 14 52217766 missense probably damaging 1.00
IGL01083:Chd8 APN 14 52221420 missense probably damaging 1.00
IGL01313:Chd8 APN 14 52210575 missense probably damaging 1.00
IGL01396:Chd8 APN 14 52204587 unclassified probably benign
IGL01476:Chd8 APN 14 52205490 missense probably benign 0.32
IGL01731:Chd8 APN 14 52212654 missense probably benign 0.12
IGL01895:Chd8 APN 14 52199094 missense probably benign 0.00
IGL02090:Chd8 APN 14 52227234 critical splice donor site probably null
IGL02344:Chd8 APN 14 52201650 missense probably damaging 1.00
IGL02573:Chd8 APN 14 52219734 missense possibly damaging 0.95
IGL02601:Chd8 APN 14 52214300 missense possibly damaging 0.94
IGL02617:Chd8 APN 14 52235191 missense probably benign 0.34
IGL02873:Chd8 APN 14 52222513 missense probably damaging 0.99
IGL02974:Chd8 APN 14 52201701 unclassified probably null
IGL03058:Chd8 APN 14 52218273 missense probably damaging 1.00
IGL03076:Chd8 APN 14 52226162 splice site probably benign
IGL03239:Chd8 APN 14 52227548 missense possibly damaging 0.92
PIT4431001:Chd8 UTSW 14 52218249 missense probably damaging 0.98
PIT4468001:Chd8 UTSW 14 52207996 missense probably benign
PIT4468001:Chd8 UTSW 14 52217881 missense possibly damaging 0.95
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0022:Chd8 UTSW 14 52232855 missense probably benign 0.00
R0115:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0132:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0419:Chd8 UTSW 14 52204060 missense probably benign 0.24
R0440:Chd8 UTSW 14 52204826 missense possibly damaging 0.91
R0452:Chd8 UTSW 14 52214587 missense probably damaging 1.00
R0481:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0624:Chd8 UTSW 14 52219757 missense possibly damaging 0.65
R0650:Chd8 UTSW 14 52202304 missense probably benign 0.09
R0691:Chd8 UTSW 14 52213433 missense probably damaging 0.96
R0790:Chd8 UTSW 14 52204025 missense probably benign 0.07
R0835:Chd8 UTSW 14 52204025 missense probably benign 0.07
R1180:Chd8 UTSW 14 52221108 missense probably damaging 1.00
R1411:Chd8 UTSW 14 52224646 missense probably benign
R1725:Chd8 UTSW 14 52232573 missense probably benign 0.08
R1839:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1968:Chd8 UTSW 14 52220993 missense probably damaging 0.98
R2020:Chd8 UTSW 14 52215241 missense probably damaging 1.00
R2024:Chd8 UTSW 14 52231493 missense probably benign 0.23
R2139:Chd8 UTSW 14 52236971 missense probably benign 0.32
R2163:Chd8 UTSW 14 52198818 missense possibly damaging 0.53
R2342:Chd8 UTSW 14 52205217 missense probably benign 0.25
R2844:Chd8 UTSW 14 52204495 missense possibly damaging 0.92
R3500:Chd8 UTSW 14 52205653 missense probably benign 0.00
R3861:Chd8 UTSW 14 52237121 missense probably benign 0.13
R4154:Chd8 UTSW 14 52207211 unclassified probably benign
R4445:Chd8 UTSW 14 52204527 unclassified probably null
R4628:Chd8 UTSW 14 52206915 missense probably benign 0.03
R4779:Chd8 UTSW 14 52231506 missense probably damaging 1.00
R4783:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R4784:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R5001:Chd8 UTSW 14 52203915 missense probably benign 0.09
R5280:Chd8 UTSW 14 52205125 missense possibly damaging 0.68
R5331:Chd8 UTSW 14 52202114 intron probably benign
R5348:Chd8 UTSW 14 52232698 missense probably damaging 1.00
R5375:Chd8 UTSW 14 52204154 missense probably damaging 1.00
R5470:Chd8 UTSW 14 52212609 missense probably damaging 1.00
R5479:Chd8 UTSW 14 52215195 missense probably benign 0.15
R5488:Chd8 UTSW 14 52213048 intron probably benign
R5489:Chd8 UTSW 14 52213048 intron probably benign
R5499:Chd8 UTSW 14 52204431 critical splice donor site probably null
R5988:Chd8 UTSW 14 52217938 missense probably damaging 1.00
R6046:Chd8 UTSW 14 52221071 missense possibly damaging 0.60
R6125:Chd8 UTSW 14 52207034 missense probably benign 0.16
R6212:Chd8 UTSW 14 52201698 missense probably damaging 1.00
R6337:Chd8 UTSW 14 52204109 missense probably damaging 1.00
R6394:Chd8 UTSW 14 52202585 missense possibly damaging 0.66
R6576:Chd8 UTSW 14 52216076 missense probably damaging 1.00
R6590:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6690:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6786:Chd8 UTSW 14 52226668 missense probably benign 0.33
R6913:Chd8 UTSW 14 52214494 missense probably damaging 0.99
R7090:Chd8 UTSW 14 52215220 missense probably damaging 0.99
R7107:Chd8 UTSW 14 52212672 missense probably benign 0.07
R7138:Chd8 UTSW 14 52214498 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGGTATTGTGAAGTAGGCCCAATG -3'
(R):5'- TCCCCAATCTGGAGAGTCTGAC -3'

Sequencing Primer
(F):5'- TAGGCCCAATGAATAATAGAGGTAC -3'
(R):5'- CCAATCTGGAGAGTCTGACTTTAAAG -3'
Posted On2014-06-23