Incidental Mutation 'R0624:Chd8'
ID58837
Institutional Source Beutler Lab
Gene Symbol Chd8
Ensembl Gene ENSMUSG00000053754
Gene Namechromodomain helicase DNA binding protein 8
SynonymsDuplin, 5830451P18Rik
MMRRC Submission 038813-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0624 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52198151-52237791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52219757 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 918 (G918D)
Ref Sequence ENSEMBL: ENSMUSP00000087184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000200169]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089752
AA Change: G918D

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: G918D

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149694
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155614
Predicted Effect possibly damaging
Transcript: ENSMUST00000200169
AA Change: G918D

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: G918D

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.2%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,268,457 E494K probably damaging Het
Abca9 T A 11: 110,139,620 D767V probably damaging Het
Add1 T A 5: 34,605,853 N128K probably damaging Het
Ado A T 10: 67,548,228 D182E probably benign Het
Anapc4 T A 5: 52,845,419 noncoding transcript Het
Ano10 A G 9: 122,259,595 probably benign Het
Apba2 A G 7: 64,714,515 probably null Het
Apc2 A G 10: 80,314,583 T1795A probably benign Het
Atp4a A G 7: 30,718,999 N571D probably benign Het
Birc6 A G 17: 74,580,349 N891D probably benign Het
Car3 G T 3: 14,866,804 M78I noncoding transcript Het
Cc2d2a A T 5: 43,730,029 H1328L probably benign Het
Cdk18 A G 1: 132,118,872 L192P probably damaging Het
Cdk9 A T 2: 32,709,824 Y185N probably damaging Het
Ceacam5 A T 7: 17,714,963 T85S probably benign Het
Cenpe A G 3: 135,246,586 T1403A probably benign Het
Csnk1e T A 15: 79,419,898 noncoding transcript Het
Dctpp1 A T 7: 127,257,193 I119N probably damaging Het
Defb34 T A 8: 19,123,768 F6Y unknown Het
Dvl1 C G 4: 155,854,775 N248K probably damaging Het
Dync1h1 T C 12: 110,651,747 noncoding transcript Het
Eml5 T A 12: 98,865,479 R407W probably damaging Het
Epb41l5 T C 1: 119,623,958 D99G probably damaging Het
Fat1 A T 8: 45,051,168 N4566I possibly damaging Het
Gm21834 T C 17: 57,742,020 E67G possibly damaging Het
Gsap T A 5: 21,253,951 probably null Het
Guf1 T C 5: 69,558,580 I121T probably damaging Het
Hsd3b5 T C 3: 98,619,404 D242G probably damaging Het
Inadl T C 4: 98,681,235 probably benign Het
Kcna7 A G 7: 45,409,690 D467G probably null Het
Lars A G 18: 42,242,784 probably benign Het
Lrrc56 A T 7: 141,206,453 D248V probably damaging Het
Map3k14 T A 11: 103,242,291 E27V possibly damaging Het
Med12l G A 3: 59,037,702 W116* probably null Het
Mgll A G 6: 88,725,817 R33G probably damaging Het
Mmp13 A G 9: 7,280,221 S384G possibly damaging Het
Nalcn C T 14: 123,370,032 C675Y probably benign Het
Nrxn1 A G 17: 91,088,689 L13P unknown Het
Ocstamp A G 2: 165,397,852 V138A probably damaging Het
Olfr1120 T G 2: 87,357,682 Y79* probably null Het
Olfr1240 A G 2: 89,440,138 V47A possibly damaging Het
Olfr1303 T C 2: 111,814,711 N5S probably damaging Het
Olfr1505 T G 19: 13,919,444 C141W probably damaging Het
Olfr372 T A 8: 72,058,162 S161T possibly damaging Het
Olfr470 A G 7: 107,845,116 S206P possibly damaging Het
Pcdhb22 A G 18: 37,518,727 I83V probably benign Het
Pclo A G 5: 14,669,656 E1269G unknown Het
Plagl2 T C 2: 153,236,053 T3A probably benign Het
Plcb1 C T 2: 135,294,911 P309S possibly damaging Het
Pld3 A T 7: 27,539,575 L175Q possibly damaging Het
Prrx1 A G 1: 163,248,405 noncoding transcript Het
Psap T G 10: 60,299,566 noncoding transcript Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Reep2 A T 18: 34,840,771 I6F probably benign Het
Rraga A G 4: 86,576,217 E100G probably benign Het
Rrm2b T C 15: 37,931,645 D249G probably null Het
Rtl1 T C 12: 109,592,719 I895M probably damaging Het
Ryr1 G A 7: 29,074,609 A2445V probably damaging Het
Sbf1 C T 15: 89,302,329 D898N possibly damaging Het
Sh3d19 G A 3: 86,114,906 V548I possibly damaging Het
Shf C A 2: 122,368,635 probably benign Het
Sipa1l3 T C 7: 29,387,251 E638G probably damaging Het
Slc13a3 G T 2: 165,411,887 P491T probably damaging Het
Slc2a13 C T 15: 91,350,012 V374I possibly damaging Het
Slc4a7 T C 14: 14,794,059 probably null Het
Slc7a2 T A 8: 40,908,531 S414T probably benign Het
Slc9c1 A G 16: 45,573,356 E554G probably benign Het
Smad2 T C 18: 76,299,993 I332T probably damaging Het
Snrnp40 C T 4: 130,362,658 P59S probably damaging Het
Sorcs2 A T 5: 36,065,433 I326N probably damaging Het
Sort1 G A 3: 108,348,630 G631S probably damaging Het
Sox10 T C 15: 79,159,386 D149G possibly damaging Het
Spn C T 7: 127,136,208 V376M possibly damaging Het
Tacc2 A G 7: 130,577,509 D9G probably damaging Het
Tapt1 T G 5: 44,177,106 L514F possibly damaging Het
Tcf3 A G 10: 80,413,334 L480P probably damaging Het
Tenm4 G C 7: 96,774,020 G682A probably damaging Het
Tex14 T A 11: 87,520,699 N950K probably benign Het
Tgfbrap1 T G 1: 43,059,129 H497P probably benign Het
Tnfrsf18 A T 4: 156,026,529 Y48F possibly damaging Het
Tnxb A C 17: 34,683,548 H1002P probably damaging Het
Ttn A G 2: 76,763,227 noncoding transcript Het
Ugt2b34 C G 5: 86,893,732 probably null Het
Vldlr A G 19: 27,238,263 D220G possibly damaging Het
Vmn1r33 A T 6: 66,612,137 Y144* probably null Het
Wdr60 T C 12: 116,248,290 D199G probably damaging Het
Wdr78 T C 4: 103,072,857 noncoding transcript Het
Xrcc4 T C 13: 89,992,475 E205G possibly damaging Het
Other mutations in Chd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Chd8 APN 14 52226138 missense probably damaging 0.99
IGL00694:Chd8 APN 14 52217970 unclassified probably damaging 1.00
IGL01011:Chd8 APN 14 52231532 missense possibly damaging 0.86
IGL01022:Chd8 APN 14 52236993 missense probably benign
IGL01066:Chd8 APN 14 52217766 missense probably damaging 1.00
IGL01083:Chd8 APN 14 52221420 missense probably damaging 1.00
IGL01313:Chd8 APN 14 52210575 missense probably damaging 1.00
IGL01396:Chd8 APN 14 52204587 unclassified noncoding transcript
IGL01476:Chd8 APN 14 52205490 missense probably benign 0.05
IGL01731:Chd8 APN 14 52212654 missense probably benign 0.05
IGL01895:Chd8 APN 14 52199094 missense probably benign
IGL02090:Chd8 APN 14 52227234 unclassified probably benign
IGL02344:Chd8 APN 14 52201650 missense possibly damaging 0.91
IGL02573:Chd8 APN 14 52219734 missense possibly damaging 0.95
IGL02601:Chd8 APN 14 52214300 missense possibly damaging 0.82
IGL02617:Chd8 APN 14 52235191 missense probably benign 0.34
IGL02873:Chd8 APN 14 52222513 missense probably damaging 0.99
IGL02974:Chd8 APN 14 52201701 missense probably benign
IGL03058:Chd8 APN 14 52218273 missense probably damaging 1.00
IGL03076:Chd8 APN 14 52226162 unclassified noncoding transcript
IGL03239:Chd8 APN 14 52227548 missense possibly damaging 0.92
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0022:Chd8 UTSW 14 52232855 missense probably benign 0.00
R0115:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0131:Chd8 UTSW 14 52205326 missense probably benign
R0131:Chd8 UTSW 14 52205326 missense probably benign
R0132:Chd8 UTSW 14 52205326 missense probably benign
R0419:Chd8 UTSW 14 52204060 missense probably benign 0.06
R0440:Chd8 UTSW 14 52204826 missense possibly damaging 0.91
R0452:Chd8 UTSW 14 52214587 missense probably damaging 1.00
R0481:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0650:Chd8 UTSW 14 52202304 missense probably benign 0.02
R0691:Chd8 UTSW 14 52213433 missense probably damaging 0.96
R0790:Chd8 UTSW 14 52204025 missense probably benign
R0835:Chd8 UTSW 14 52204025 missense probably benign
R1180:Chd8 UTSW 14 52221108 missense probably damaging 1.00
R1411:Chd8 UTSW 14 52224646 missense probably benign
R1725:Chd8 UTSW 14 52232573 missense probably benign 0.08
R1838:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1839:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1968:Chd8 UTSW 14 52220993 missense probably damaging 0.98
R2020:Chd8 UTSW 14 52215241 missense probably damaging 1.00
R2024:Chd8 UTSW 14 52231493 missense probably benign 0.23
R2139:Chd8 UTSW 14 52236971 missense probably benign 0.32
R2163:Chd8 UTSW 14 52198818 missense possibly damaging 0.66
R2342:Chd8 UTSW 14 52205217 missense probably benign 0.01
R2844:Chd8 UTSW 14 52204495 missense possibly damaging 0.92
R3500:Chd8 UTSW 14 52205653 missense probably benign 0.00
R3861:Chd8 UTSW 14 52237121 missense probably benign 0.13
R4154:Chd8 UTSW 14 52207211 intron noncoding transcript
R4445:Chd8 UTSW 14 52204527 missense probably benign 0.01
R4628:Chd8 UTSW 14 52206915 missense probably benign 0.02
R4779:Chd8 UTSW 14 52231506 missense probably damaging 1.00
R4783:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R4784:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R5001:Chd8 UTSW 14 52203915 missense probably benign 0.02
R5280:Chd8 UTSW 14 52205125 missense possibly damaging 0.68
R5331:Chd8 UTSW 14 52202114 intron noncoding transcript
R5348:Chd8 UTSW 14 52232698 missense probably damaging 1.00
R5375:Chd8 UTSW 14 52204154 missense probably damaging 0.99
R5470:Chd8 UTSW 14 52212609 missense probably damaging 1.00
R5479:Chd8 UTSW 14 52215195 missense probably benign 0.15
R5488:Chd8 UTSW 14 52213048 intron noncoding transcript
R5489:Chd8 UTSW 14 52213048 intron noncoding transcript
R5499:Chd8 UTSW 14 52204431 critical splice donor site probably null
R5988:Chd8 UTSW 14 52217938 missense probably damaging 1.00
R6046:Chd8 UTSW 14 52221071 missense possibly damaging 0.60
R6125:Chd8 UTSW 14 52207034 missense probably benign 0.00
R6212:Chd8 UTSW 14 52201698 missense probably benign 0.07
R6337:Chd8 UTSW 14 52204109 missense possibly damaging 0.93
R6394:Chd8 UTSW 14 52202585 missense probably benign 0.26
R6576:Chd8 UTSW 14 52216076 missense probably damaging 1.00
R6593:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GCTCCTTGTGACTAAGAAGCACCC -3'
(R):5'- GAAGATACCTGGCTTGGCTTCCAC -3'

Sequencing Primer
(F):5'- GACGTTTACACGATCTCCAGG -3'
(R):5'- caccaccacccccactc -3'
Posted OnJul 11, 2013