Mutagenetix > Incidental Mutation

Incidental Mutation 'E0370:Psmc3'

206401

Institutional Source

Beutler Lab

Gene Symbol

Psmc3

Ensembl Gene

ENSMUSG00000002102

Gene Name

proteasome (prosome, macropain) 26S subunit, ATPase 3

Synonyms

Tat binding protein 1, TBP-1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

E0370 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90884361-90889783 bp(+) (GRCm39)

Type of Mutation

splice site (14 bp from exon)

DNA Base Change (assembly)

T to A at 90885463 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000139782 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002171] [ENSMUST00000067663] [ENSMUST00000111441] [ENSMUST00000185715]

AlphaFold

O88685

Predicted Effect

probably null
Transcript: ENSMUST00000002171

SMART Domains

Protein: ENSMUSP00000002171
Gene: ENSMUSG00000002102

Domain	Start	End	E-Value	Type
AAA	222	361	6.65e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000067663

SMART Domains

Protein: ENSMUSP00000071054
Gene: ENSMUSG00000002102

Domain	Start	End	E-Value	Type
AAA	222	361	6.65e-22	SMART
Blast:AAA	390	436	9e-20	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000111441

SMART Domains

Protein: ENSMUSP00000107068
Gene: ENSMUSG00000002102

Domain	Start	End	E-Value	Type
AAA	180	319	6.65e-22	SMART
Blast:AAA	348	394	8e-20	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131473

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141462

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144822

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145317

Predicted Effect

probably benign
Transcript: ENSMUST00000146506

SMART Domains

Protein: ENSMUSP00000121688
Gene: ENSMUSG00000002102

Domain	Start	End	E-Value	Type
PDB:4CR4\|M	13	183	2e-69	PDB
Blast:AAA	140	183	1e-20	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000185715

SMART Domains

Protein: ENSMUSP00000139782
Gene: ENSMUSG00000002102

Domain	Start	End	E-Value	Type
AAA	203	301	9e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152269

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146633

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.1%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases that have chaperone-like activity. This subunit may compete with PSMC2 for binding to the HIV tat protein to regulate the interaction between the viral protein and the transcription complex. A pseudogene has been identified on chromosome 9. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544D05Rik	TGCAGCGACTGGACGGCGGCA	TGCA	11: 70,507,252 (GRCm39)		probably null	Het
Aire	T	A	10: 77,877,897 (GRCm39)	N180I	probably damaging	Het
Asic3	G	T	5: 24,618,985 (GRCm39)	L92F	probably damaging	Het
Birc6	G	A	17: 74,984,352 (GRCm39)	D4455N	probably damaging	Het
Cd36	A	T	5: 17,990,747 (GRCm39)	C464*	probably null	Het
Cdx1	A	C	18: 61,153,501 (GRCm39)	I179S	probably damaging	Het
Dnah2	A	T	11: 69,406,441 (GRCm39)		probably null	Het
Dst	A	T	1: 34,288,552 (GRCm39)		probably benign	Het
Epb41l3	A	G	17: 69,581,799 (GRCm39)	N580S	possibly damaging	Het
Hnrnpm	A	T	17: 33,877,896 (GRCm39)		probably benign	Het
Katnip	A	G	7: 125,449,474 (GRCm39)	D846G	probably benign	Het
Map2	A	T	1: 66,455,883 (GRCm39)		probably benign	Het
Mapk11	T	C	15: 89,030,716 (GRCm39)	D88G	probably damaging	Het
Mbd4	C	T	6: 115,826,116 (GRCm39)	E271K	possibly damaging	Het
Mpp4	T	G	1: 59,178,917 (GRCm39)		probably benign	Het
Mtarc1	T	C	1: 184,527,425 (GRCm39)		probably benign	Het
Muc2	T	C	7: 141,282,598 (GRCm39)	Y609H	probably damaging	Het
Or8b3b	A	T	9: 38,583,857 (GRCm39)	D307E	probably damaging	Het
Pex1	T	A	5: 3,681,614 (GRCm39)		probably null	Het
Prdm11	T	C	2: 92,810,924 (GRCm39)	Y225C	probably damaging	Het
Slc26a8	A	T	17: 28,861,361 (GRCm39)	D774E	possibly damaging	Het
Slc9a2	A	T	1: 40,802,701 (GRCm39)		probably null	Het
Smc1b	A	G	15: 85,011,782 (GRCm39)	Y168H	probably damaging	Het
Steap1	T	C	5: 5,790,673 (GRCm39)	R92G	probably damaging	Het
Tbx22	T	C	X: 106,728,759 (GRCm39)	I430T	probably benign	Het
Tfap4	T	A	16: 4,377,334 (GRCm39)	H16L	possibly damaging	Het
Tnxb	A	G	17: 34,897,917 (GRCm39)	D855G	probably damaging	Het
Trip13	A	G	13: 74,068,558 (GRCm39)		probably benign	Het
Ubxn4	G	A	1: 128,190,641 (GRCm39)	E256K	probably benign	Het
Vmn2r121	A	G	X: 123,037,617 (GRCm39)	V801A	probably benign	Het
Wiz	C	T	17: 32,574,092 (GRCm39)	R935Q	probably damaging	Het

Other mutations in Psmc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0747:Psmc3	UTSW	2	90,884,645 (GRCm39)	missense	probably benign	0.10
R1182:Psmc3	UTSW	2	90,886,380 (GRCm39)	missense	probably damaging	1.00
R1763:Psmc3	UTSW	2	90,886,340 (GRCm39)	missense	possibly damaging	0.81
R1967:Psmc3	UTSW	2	90,888,189 (GRCm39)	missense	probably benign	0.19
R2056:Psmc3	UTSW	2	90,888,433 (GRCm39)	missense	probably benign	0.40
R2484:Psmc3	UTSW	2	90,886,346 (GRCm39)	missense	probably damaging	0.97
R3411:Psmc3	UTSW	2	90,886,263 (GRCm39)	missense	probably damaging	1.00
R3608:Psmc3	UTSW	2	90,884,925 (GRCm39)	missense	probably benign	0.00
R4917:Psmc3	UTSW	2	90,896,317 (GRCm39)	unclassified	probably benign
R4954:Psmc3	UTSW	2	90,885,974 (GRCm39)	intron	probably benign
R5033:Psmc3	UTSW	2	90,884,953 (GRCm39)	missense	probably benign	0.03
R5073:Psmc3	UTSW	2	90,884,915 (GRCm39)	splice site	probably benign
R5279:Psmc3	UTSW	2	90,884,667 (GRCm39)	missense	probably benign
R5354:Psmc3	UTSW	2	90,889,698 (GRCm39)	missense	probably damaging	1.00
R6169:Psmc3	UTSW	2	90,888,184 (GRCm39)	missense	probably damaging	1.00
R6224:Psmc3	UTSW	2	90,884,975 (GRCm39)	missense	probably damaging	1.00
R7039:Psmc3	UTSW	2	90,885,391 (GRCm39)	missense	probably benign	0.32
R7275:Psmc3	UTSW	2	90,886,275 (GRCm39)	missense	probably damaging	0.97
R7962:Psmc3	UTSW	2	90,887,007 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

Posted On

2014-06-23