Incidental Mutation 'E0370:Vmn2r121'
ID206428
Institutional Source Beutler Lab
Gene Symbol Vmn2r121
Ensembl Gene ENSMUSG00000072049
Gene Namevomeronasal 2, receptor 121
SynonymsEG625699
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #E0370 (G1)
Quality Score225
Status Validated
ChromosomeX
Chromosomal Location124127339-124135910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124127920 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 801 (V801A)
Ref Sequence ENSEMBL: ENSMUSP00000092067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094491]
Predicted Effect probably benign
Transcript: ENSMUST00000094491
AA Change: V801A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000092067
Gene: ENSMUSG00000072049
AA Change: V801A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 75 448 3.2e-26 PFAM
Pfam:NCD3G 506 560 2.1e-19 PFAM
Pfam:7tm_3 593 828 3.8e-56 PFAM
Meta Mutation Damage Score 0.1616 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.1%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik TGCAGCGACTGGACGGCGGCA TGCA 11: 70,616,426 probably null Het
Aire T A 10: 78,042,063 N180I probably damaging Het
Asic3 G T 5: 24,413,987 L92F probably damaging Het
Birc6 G A 17: 74,677,357 D4455N probably damaging Het
Cd36 A T 5: 17,785,749 C464* probably null Het
Cdx1 A C 18: 61,020,429 I179S probably damaging Het
D430042O09Rik A G 7: 125,850,302 D846G probably benign Het
Dnah2 A T 11: 69,515,615 probably null Het
Dst A T 1: 34,249,471 probably benign Het
Epb41l3 A G 17: 69,274,804 N580S possibly damaging Het
Hnrnpm A T 17: 33,658,922 probably benign Het
Map2 A T 1: 66,416,724 probably benign Het
Mapk11 T C 15: 89,146,513 D88G probably damaging Het
Marc1 T C 1: 184,795,228 probably benign Het
Mbd4 C T 6: 115,849,155 E271K possibly damaging Het
Mpp4 T G 1: 59,139,758 probably benign Het
Muc2 T C 7: 141,696,355 Y609H probably damaging Het
Olfr918 A T 9: 38,672,561 D307E probably damaging Het
Pex1 T A 5: 3,631,614 probably null Het
Prdm11 T C 2: 92,980,579 Y225C probably damaging Het
Psmc3 T A 2: 91,055,118 probably null Het
Slc26a8 A T 17: 28,642,387 D774E possibly damaging Het
Slc9a2 A T 1: 40,763,541 probably null Het
Smc1b A G 15: 85,127,581 Y168H probably damaging Het
Steap1 T C 5: 5,740,673 R92G probably damaging Het
Tbx22 T C X: 107,685,153 I430T probably benign Het
Tfap4 T A 16: 4,559,470 H16L possibly damaging Het
Tnxb A G 17: 34,678,943 D855G probably damaging Het
Trip13 A G 13: 73,920,439 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Wiz C T 17: 32,355,118 R935Q probably damaging Het
Other mutations in Vmn2r121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r121 APN X 124127802 missense probably benign 0.04
IGL00990:Vmn2r121 APN X 124127783 missense possibly damaging 0.95
IGL00990:Vmn2r121 APN X 124133716 missense probably benign 0.00
IGL01125:Vmn2r121 APN X 124132807 missense probably damaging 0.99
IGL01450:Vmn2r121 APN X 124131191 missense possibly damaging 0.57
IGL01619:Vmn2r121 APN X 124132300 missense probably benign
IGL01797:Vmn2r121 APN X 124131351 splice site probably benign
IGL02227:Vmn2r121 APN X 124132681 missense probably benign 0.44
IGL02971:Vmn2r121 APN X 124127894 missense probably damaging 1.00
IGL03058:Vmn2r121 APN X 124132921 missense probably benign 0.00
IGL03142:Vmn2r121 APN X 124132938 missense possibly damaging 0.94
IGL03183:Vmn2r121 APN X 124132326 missense probably benign 0.03
R0196:Vmn2r121 UTSW X 124132182 missense probably benign 0.03
R1381:Vmn2r121 UTSW X 124128140 missense probably damaging 1.00
R1399:Vmn2r121 UTSW X 124129848 missense possibly damaging 0.94
R1423:Vmn2r121 UTSW X 124129905 missense possibly damaging 0.52
R1687:Vmn2r121 UTSW X 124132791 missense probably benign 0.39
R2121:Vmn2r121 UTSW X 124133742 splice site probably null
R2124:Vmn2r121 UTSW X 124133742 splice site probably null
R3151:Vmn2r121 UTSW X 124131152 missense probably benign 0.20
R4460:Vmn2r121 UTSW X 124128584 missense probably benign 0.01
R4735:Vmn2r121 UTSW X 124128638 missense probably benign
R5332:Vmn2r121 UTSW X 124133575 missense probably benign
R6102:Vmn2r121 UTSW X 124133575 missense probably benign
X0023:Vmn2r121 UTSW X 124135657 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TTGTAAGCACACATCTGTATGTTAC -3'
(R):5'- CACGTTGTCCTGGGATACTTGG -3'

Sequencing Primer
(F):5'- CCATGAAAGTTTCAATTAAGCA -3'
(R):5'- TCCTGGGATACTTGGGTTCC -3'
Posted On2014-06-23