Incidental Mutation 'R1847:Pafah2'
ID207791
Institutional Source Beutler Lab
Gene Symbol Pafah2
Ensembl Gene ENSMUSG00000037366
Gene Nameplatelet-activating factor acetylhydrolase 2
Synonyms
MMRRC Submission 039872-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1847 (G1)
Quality Score124
Status Validated
Chromosome4
Chromosomal Location134396320-134427413 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCCCC to GCCCCC at 134425541 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105869] [ENSMUST00000105870]
Predicted Effect probably null
Transcript: ENSMUST00000105869
SMART Domains Protein: ENSMUSP00000101495
Gene: ENSMUSG00000037366

DomainStartEndE-ValueType
Pfam:PAF-AH_p_II 1 379 4.7e-157 PFAM
Pfam:Chlorophyllase2 92 263 4.4e-9 PFAM
Pfam:Abhydrolase_5 102 313 1.2e-16 PFAM
Pfam:Abhydrolase_6 103 276 7.2e-9 PFAM
Pfam:Peptidase_S9 200 265 1.8e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105870
SMART Domains Protein: ENSMUSP00000101496
Gene: ENSMUSG00000037366

DomainStartEndE-ValueType
Pfam:PAF-AH_p_II 26 404 8e-157 PFAM
Pfam:DLH 116 342 1.1e-6 PFAM
Pfam:Abhydrolase_5 127 338 4.8e-17 PFAM
Pfam:Peptidase_S9 226 291 5.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145626
Meta Mutation Damage Score 0.5972 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes platelet-activating factor acetylhydrolase isoform 2, a single-subunit intracellular enzyme that catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). However, this lipase exhibits a broader substrate specificity than simply platelet activating factor. Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist, and both are multi-subunit enzymes. Additionally, there is a single-subunit serum isoform of this enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased sensitivity to hepatic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C A 16: 14,445,449 R758S probably benign Het
Acnat1 A T 4: 49,447,716 H288Q possibly damaging Het
Adamts1 T C 16: 85,802,226 E162G possibly damaging Het
Akap11 A G 14: 78,513,661 S429P probably benign Het
Alg14 T C 3: 121,361,766 Y212H probably damaging Het
Cacna1g T C 11: 94,466,181 T97A probably damaging Het
Ccdc112 T A 18: 46,287,754 N310Y possibly damaging Het
Cenpl A T 1: 161,086,004 Y328F probably damaging Het
Cep162 G A 9: 87,204,080 H1064Y probably benign Het
Cnksr3 T A 10: 7,154,324 E126D probably benign Het
Ctsh T A 9: 90,061,565 M81K probably benign Het
D6Wsu163e A G 6: 126,955,149 T284A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnaaf1 T A 8: 119,582,877 M196K probably benign Het
Dnah9 C A 11: 65,834,386 G4314C probably damaging Het
Dph1 A G 11: 75,179,731 Y361H probably damaging Het
Ect2 C T 3: 27,150,072 M29I probably benign Het
Eif3h T C 15: 51,797,670 Y167C probably damaging Het
Epc2 C T 2: 49,532,089 R332C probably damaging Het
Fras1 C A 5: 96,749,423 probably null Het
Gfm2 A G 13: 97,162,934 I386V probably benign Het
Gpd1l G A 9: 114,914,331 T167I probably damaging Het
Hsph1 T A 5: 149,623,485 K567* probably null Het
Igfn1 T G 1: 135,969,388 S1147R probably benign Het
Itgb4 T C 11: 115,983,764 V406A probably benign Het
Kcna2 A G 3: 107,105,113 I337V possibly damaging Het
Kcnab1 T C 3: 65,302,194 probably null Het
Kri1 G T 9: 21,280,492 probably benign Het
Lrguk T A 6: 34,133,387 I801K possibly damaging Het
Magi2 A T 5: 20,602,460 N871Y probably damaging Het
Map3k10 G T 7: 27,661,556 probably null Het
Mrps25 T C 6: 92,178,740 T71A probably damaging Het
Myo15 G A 11: 60,499,495 W945* probably null Het
Ncan A T 8: 70,102,454 I1021N probably damaging Het
Ncf4 C A 15: 78,250,382 S11R probably benign Het
Neb A C 2: 52,196,295 S5255R possibly damaging Het
Nop2 TGATGAAGATGAAGATGA TGATGAAGATGA 6: 125,137,079 probably benign Het
Olfr1155 T C 2: 87,942,721 probably null Het
Olfr1189 G A 2: 88,592,172 A123T probably damaging Het
Olfr992 A T 2: 85,400,441 F31I probably damaging Het
Pacs1 T C 19: 5,153,714 I328V probably damaging Het
Pan2 A G 10: 128,304,378 H56R possibly damaging Het
Pigo G A 4: 43,024,710 R124* probably null Het
Ppfia2 A G 10: 106,927,710 D1188G probably benign Het
Ppp1r16b A G 2: 158,761,435 N327D probably damaging Het
Psd3 A G 8: 67,720,004 C223R possibly damaging Het
Rad50 A G 11: 53,702,107 V72A possibly damaging Het
Rcor3 T A 1: 192,100,833 D445V possibly damaging Het
Rundc1 T A 11: 101,433,681 H404Q probably benign Het
Ryr1 T C 7: 29,079,811 K2083E probably benign Het
Scd3 C A 19: 44,235,842 H171Q probably damaging Het
Scrn2 T C 11: 97,032,195 F155L probably benign Het
Serpina12 A T 12: 104,032,510 L323Q probably damaging Het
Sptlc3 T A 2: 139,625,923 M467K probably benign Het
Stard9 G T 2: 120,698,489 R1742S possibly damaging Het
Thbd A T 2: 148,407,684 L88* probably null Het
Tln2 G A 9: 67,362,687 Q477* probably null Het
Tnn T A 1: 160,116,182 E1020D possibly damaging Het
Trip12 A T 1: 84,749,269 H3Q probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmp1 G A 11: 86,643,587 Q165* probably null Het
Zfp758 T A 17: 22,375,223 M230K probably benign Het
Other mutations in Pafah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03283:Pafah2 APN 4 134418097 missense probably damaging 1.00
R0368:Pafah2 UTSW 4 134422491 missense probably benign 0.37
R1456:Pafah2 UTSW 4 134404157 missense probably damaging 1.00
R1765:Pafah2 UTSW 4 134413447 missense probably benign 0.04
R1846:Pafah2 UTSW 4 134425541 frame shift probably null
R1848:Pafah2 UTSW 4 134425541 frame shift probably null
R2984:Pafah2 UTSW 4 134411871 missense possibly damaging 0.94
R5921:Pafah2 UTSW 4 134418069 missense probably benign 0.17
R6088:Pafah2 UTSW 4 134413381 missense probably benign 0.02
R7289:Pafah2 UTSW 4 134419997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTCCCACTAGCTCAAATG -3'
(R):5'- CAATCAGCCAGTGATCTGAGG -3'

Sequencing Primer
(F):5'- TAGACCCAGCTGTCCCGAC -3'
(R):5'- CTGAGGTGCGTTTAAGATCAACAACC -3'
Posted On2014-06-23