Incidental Mutation 'R1847:Tln2'
ID207807
Institutional Source Beutler Lab
Gene Symbol Tln2
Ensembl Gene ENSMUSG00000052698
Gene Nametalin 2
Synonyms
MMRRC Submission 039872-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R1847 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location67217087-67559703 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 67362687 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 477 (Q477*)
Ref Sequence ENSEMBL: ENSMUSP00000148901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215784]
Predicted Effect probably null
Transcript: ENSMUST00000039662
AA Change: Q475*
SMART Domains Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698
AA Change: Q475*

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 3.4e-59 PFAM
Pfam:I_LWEQ 661 765 1.9e-10 PFAM
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 2.6e-67 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2384 2531 2.5e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000040025
AA Change: Q475*
SMART Domains Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698
AA Change: Q475*

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 8.5e-78 PFAM
low complexity region 674 693 N/A INTRINSIC
internal_repeat_2 703 763 2.05e-7 PROSPERO
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 9.9e-72 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2383 2533 4.3e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215784
AA Change: Q477*
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C A 16: 14,445,449 R758S probably benign Het
Acnat1 A T 4: 49,447,716 H288Q possibly damaging Het
Adamts1 T C 16: 85,802,226 E162G possibly damaging Het
Akap11 A G 14: 78,513,661 S429P probably benign Het
Alg14 T C 3: 121,361,766 Y212H probably damaging Het
Cacna1g T C 11: 94,466,181 T97A probably damaging Het
Ccdc112 T A 18: 46,287,754 N310Y possibly damaging Het
Cenpl A T 1: 161,086,004 Y328F probably damaging Het
Cep162 G A 9: 87,204,080 H1064Y probably benign Het
Cnksr3 T A 10: 7,154,324 E126D probably benign Het
Ctsh T A 9: 90,061,565 M81K probably benign Het
D6Wsu163e A G 6: 126,955,149 T284A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnaaf1 T A 8: 119,582,877 M196K probably benign Het
Dnah9 C A 11: 65,834,386 G4314C probably damaging Het
Dph1 A G 11: 75,179,731 Y361H probably damaging Het
Ect2 C T 3: 27,150,072 M29I probably benign Het
Eif3h T C 15: 51,797,670 Y167C probably damaging Het
Epc2 C T 2: 49,532,089 R332C probably damaging Het
Fras1 C A 5: 96,749,423 probably null Het
Gfm2 A G 13: 97,162,934 I386V probably benign Het
Gpd1l G A 9: 114,914,331 T167I probably damaging Het
Hsph1 T A 5: 149,623,485 K567* probably null Het
Igfn1 T G 1: 135,969,388 S1147R probably benign Het
Itgb4 T C 11: 115,983,764 V406A probably benign Het
Kcna2 A G 3: 107,105,113 I337V possibly damaging Het
Kcnab1 T C 3: 65,302,194 probably null Het
Kri1 G T 9: 21,280,492 probably benign Het
Lrguk T A 6: 34,133,387 I801K possibly damaging Het
Magi2 A T 5: 20,602,460 N871Y probably damaging Het
Map3k10 G T 7: 27,661,556 probably null Het
Mrps25 T C 6: 92,178,740 T71A probably damaging Het
Myo15 G A 11: 60,499,495 W945* probably null Het
Ncan A T 8: 70,102,454 I1021N probably damaging Het
Ncf4 C A 15: 78,250,382 S11R probably benign Het
Neb A C 2: 52,196,295 S5255R possibly damaging Het
Nop2 TGATGAAGATGAAGATGA TGATGAAGATGA 6: 125,137,079 probably benign Het
Olfr1155 T C 2: 87,942,721 probably null Het
Olfr1189 G A 2: 88,592,172 A123T probably damaging Het
Olfr992 A T 2: 85,400,441 F31I probably damaging Het
Pacs1 T C 19: 5,153,714 I328V probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pan2 A G 10: 128,304,378 H56R possibly damaging Het
Pigo G A 4: 43,024,710 R124* probably null Het
Ppfia2 A G 10: 106,927,710 D1188G probably benign Het
Ppp1r16b A G 2: 158,761,435 N327D probably damaging Het
Psd3 A G 8: 67,720,004 C223R possibly damaging Het
Rad50 A G 11: 53,702,107 V72A possibly damaging Het
Rcor3 T A 1: 192,100,833 D445V possibly damaging Het
Rundc1 T A 11: 101,433,681 H404Q probably benign Het
Ryr1 T C 7: 29,079,811 K2083E probably benign Het
Scd3 C A 19: 44,235,842 H171Q probably damaging Het
Scrn2 T C 11: 97,032,195 F155L probably benign Het
Serpina12 A T 12: 104,032,510 L323Q probably damaging Het
Sptlc3 T A 2: 139,625,923 M467K probably benign Het
Stard9 G T 2: 120,698,489 R1742S possibly damaging Het
Thbd A T 2: 148,407,684 L88* probably null Het
Tnn T A 1: 160,116,182 E1020D possibly damaging Het
Trip12 A T 1: 84,749,269 H3Q probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmp1 G A 11: 86,643,587 Q165* probably null Het
Zfp758 T A 17: 22,375,223 M230K probably benign Het
Other mutations in Tln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tln2 APN 9 67344187 missense possibly damaging 0.59
IGL01110:Tln2 APN 9 67250582 nonsense probably null
IGL01112:Tln2 APN 9 67311811 missense probably damaging 1.00
IGL01307:Tln2 APN 9 67395467 missense probably benign 0.25
IGL01374:Tln2 APN 9 67261923 missense probably damaging 1.00
IGL01625:Tln2 APN 9 67370623 missense probably damaging 1.00
IGL01865:Tln2 APN 9 67250614 nonsense probably null
IGL01999:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02002:Tln2 APN 9 67356698 missense probably damaging 0.98
IGL02005:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02015:Tln2 APN 9 67361439 splice site probably benign
IGL02368:Tln2 APN 9 67240810 splice site probably benign
IGL02444:Tln2 APN 9 67258592 splice site probably benign
IGL02646:Tln2 APN 9 67255996 missense probably benign 0.43
IGL02744:Tln2 APN 9 67229376 nonsense probably null
IGL02869:Tln2 APN 9 67221525 splice site probably benign
IGL02930:Tln2 APN 9 67393662 nonsense probably null
IGL03100:Tln2 APN 9 67295737 missense probably damaging 1.00
IGL03326:Tln2 APN 9 67334257 missense possibly damaging 0.67
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0107:Tln2 UTSW 9 67370706 missense probably damaging 1.00
R0494:Tln2 UTSW 9 67355197 missense probably benign 0.22
R0884:Tln2 UTSW 9 67370733 missense probably damaging 1.00
R0947:Tln2 UTSW 9 67295813 missense probably benign 0.08
R0989:Tln2 UTSW 9 67229454 missense probably damaging 1.00
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1486:Tln2 UTSW 9 67311839 missense probably damaging 1.00
R1527:Tln2 UTSW 9 67272668 missense possibly damaging 0.95
R1584:Tln2 UTSW 9 67296414 missense probably damaging 1.00
R1636:Tln2 UTSW 9 67306532 missense probably damaging 1.00
R1656:Tln2 UTSW 9 67227107 missense possibly damaging 0.81
R1707:Tln2 UTSW 9 67375807 missense probably benign 0.00
R1749:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1751:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1761:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1767:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1815:Tln2 UTSW 9 67229423 missense probably damaging 1.00
R1840:Tln2 UTSW 9 67342043 missense probably damaging 1.00
R1964:Tln2 UTSW 9 67342135 missense probably benign 0.00
R1968:Tln2 UTSW 9 67255901 missense probably damaging 1.00
R2036:Tln2 UTSW 9 67272704 missense possibly damaging 0.76
R2038:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R2152:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2153:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2154:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2191:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2192:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2201:Tln2 UTSW 9 67375757 missense probably damaging 1.00
R3116:Tln2 UTSW 9 67355139 missense probably benign 0.10
R3151:Tln2 UTSW 9 67330547 critical splice donor site probably null
R3795:Tln2 UTSW 9 67255915 missense probably damaging 0.97
R3953:Tln2 UTSW 9 67370629 missense probably damaging 1.00
R4450:Tln2 UTSW 9 67344065 critical splice donor site probably null
R4685:Tln2 UTSW 9 67302572 missense probably damaging 1.00
R4688:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R4696:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4697:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4700:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4701:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4741:Tln2 UTSW 9 67386555 critical splice donor site probably null
R4806:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4807:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4808:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4967:Tln2 UTSW 9 67355125 missense probably damaging 0.97
R5061:Tln2 UTSW 9 67354468 missense probably benign
R5092:Tln2 UTSW 9 67256028 missense probably benign 0.13
R5093:Tln2 UTSW 9 67334314 missense probably benign 0.44
R5126:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R5204:Tln2 UTSW 9 67354482 missense probably benign 0.00
R5236:Tln2 UTSW 9 67365923 missense probably damaging 0.99
R5287:Tln2 UTSW 9 67242359 missense probably damaging 1.00
R5568:Tln2 UTSW 9 67311865 missense probably damaging 1.00
R5571:Tln2 UTSW 9 67334320 missense possibly damaging 0.88
R5642:Tln2 UTSW 9 67296358 missense probably benign 0.01
R5711:Tln2 UTSW 9 67392547 missense probably benign 0.00
R5776:Tln2 UTSW 9 67258250 missense probably damaging 1.00
R5791:Tln2 UTSW 9 67386605 missense probably damaging 0.98
R5866:Tln2 UTSW 9 67266868 missense probably damaging 1.00
R5888:Tln2 UTSW 9 67229403 missense probably damaging 1.00
R5902:Tln2 UTSW 9 67362717 missense probably benign 0.02
R6106:Tln2 UTSW 9 67323020 missense probably damaging 0.99
R6175:Tln2 UTSW 9 67224081 missense probably damaging 1.00
R6385:Tln2 UTSW 9 67278129 missense probably benign 0.45
R6430:Tln2 UTSW 9 67272665 missense probably damaging 1.00
R6441:Tln2 UTSW 9 67272689 missense probably damaging 1.00
R6738:Tln2 UTSW 9 67386664 missense possibly damaging 0.91
R6776:Tln2 UTSW 9 67262905 missense probably damaging 1.00
R6794:Tln2 UTSW 9 67286558 missense probably benign 0.07
R6850:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R6907:Tln2 UTSW 9 67397635 missense probably damaging 0.98
R6909:Tln2 UTSW 9 67392532 missense probably damaging 0.97
R6951:Tln2 UTSW 9 67258485 missense probably damaging 0.97
X0027:Tln2 UTSW 9 67376853 missense probably damaging 1.00
X0064:Tln2 UTSW 9 67348138 missense probably damaging 1.00
X0067:Tln2 UTSW 9 67370691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAGGGGCAATTGGTCATTC -3'
(R):5'- TGAGGTCTTCTCACTGTACTGTAC -3'

Sequencing Primer
(F):5'- GGTCATTCAATTACAGGAATGCACC -3'
(R):5'- ACTGTACTGTGTGTGAGTGTCTACC -3'
Posted On2014-06-23