Incidental Mutation 'R1847:Olfr1189'
ID207779
Institutional Source Beutler Lab
Gene Symbol Olfr1189
Ensembl Gene ENSMUSG00000068808
Gene Nameolfactory receptor 1189
SynonymsGA_x6K02T2Q125-50079044-50079964, MOR237-2
MMRRC Submission 039872-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1847 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88586454-88592762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88592172 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 123 (A123T)
Ref Sequence ENSEMBL: ENSMUSP00000149696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090700] [ENSMUST00000213679]
Predicted Effect probably damaging
Transcript: ENSMUST00000090700
AA Change: A123T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088201
Gene: ENSMUSG00000068808
AA Change: A123T

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.6e-42 PFAM
Pfam:7tm_1 39 285 4.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213679
AA Change: A123T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0232 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C A 16: 14,445,449 R758S probably benign Het
Acnat1 A T 4: 49,447,716 H288Q possibly damaging Het
Adamts1 T C 16: 85,802,226 E162G possibly damaging Het
Akap11 A G 14: 78,513,661 S429P probably benign Het
Alg14 T C 3: 121,361,766 Y212H probably damaging Het
Cacna1g T C 11: 94,466,181 T97A probably damaging Het
Ccdc112 T A 18: 46,287,754 N310Y possibly damaging Het
Cenpl A T 1: 161,086,004 Y328F probably damaging Het
Cep162 G A 9: 87,204,080 H1064Y probably benign Het
Cnksr3 T A 10: 7,154,324 E126D probably benign Het
Ctsh T A 9: 90,061,565 M81K probably benign Het
D6Wsu163e A G 6: 126,955,149 T284A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnaaf1 T A 8: 119,582,877 M196K probably benign Het
Dnah9 C A 11: 65,834,386 G4314C probably damaging Het
Dph1 A G 11: 75,179,731 Y361H probably damaging Het
Ect2 C T 3: 27,150,072 M29I probably benign Het
Eif3h T C 15: 51,797,670 Y167C probably damaging Het
Epc2 C T 2: 49,532,089 R332C probably damaging Het
Fras1 C A 5: 96,749,423 probably null Het
Gfm2 A G 13: 97,162,934 I386V probably benign Het
Gpd1l G A 9: 114,914,331 T167I probably damaging Het
Hsph1 T A 5: 149,623,485 K567* probably null Het
Igfn1 T G 1: 135,969,388 S1147R probably benign Het
Itgb4 T C 11: 115,983,764 V406A probably benign Het
Kcna2 A G 3: 107,105,113 I337V possibly damaging Het
Kcnab1 T C 3: 65,302,194 probably null Het
Kri1 G T 9: 21,280,492 probably benign Het
Lrguk T A 6: 34,133,387 I801K possibly damaging Het
Magi2 A T 5: 20,602,460 N871Y probably damaging Het
Map3k10 G T 7: 27,661,556 probably null Het
Mrps25 T C 6: 92,178,740 T71A probably damaging Het
Myo15 G A 11: 60,499,495 W945* probably null Het
Ncan A T 8: 70,102,454 I1021N probably damaging Het
Ncf4 C A 15: 78,250,382 S11R probably benign Het
Neb A C 2: 52,196,295 S5255R possibly damaging Het
Nop2 TGATGAAGATGAAGATGA TGATGAAGATGA 6: 125,137,079 probably benign Het
Olfr1155 T C 2: 87,942,721 probably null Het
Olfr992 A T 2: 85,400,441 F31I probably damaging Het
Pacs1 T C 19: 5,153,714 I328V probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,425,541 probably null Het
Pan2 A G 10: 128,304,378 H56R possibly damaging Het
Pigo G A 4: 43,024,710 R124* probably null Het
Ppfia2 A G 10: 106,927,710 D1188G probably benign Het
Ppp1r16b A G 2: 158,761,435 N327D probably damaging Het
Psd3 A G 8: 67,720,004 C223R possibly damaging Het
Rad50 A G 11: 53,702,107 V72A possibly damaging Het
Rcor3 T A 1: 192,100,833 D445V possibly damaging Het
Rundc1 T A 11: 101,433,681 H404Q probably benign Het
Ryr1 T C 7: 29,079,811 K2083E probably benign Het
Scd3 C A 19: 44,235,842 H171Q probably damaging Het
Scrn2 T C 11: 97,032,195 F155L probably benign Het
Serpina12 A T 12: 104,032,510 L323Q probably damaging Het
Sptlc3 T A 2: 139,625,923 M467K probably benign Het
Stard9 G T 2: 120,698,489 R1742S possibly damaging Het
Thbd A T 2: 148,407,684 L88* probably null Het
Tln2 G A 9: 67,362,687 Q477* probably null Het
Tnn T A 1: 160,116,182 E1020D possibly damaging Het
Trip12 A T 1: 84,749,269 H3Q probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmp1 G A 11: 86,643,587 Q165* probably null Het
Zfp758 T A 17: 22,375,223 M230K probably benign Het
Other mutations in Olfr1189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Olfr1189 APN 2 88592606 missense probably benign 0.22
R0115:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R0481:Olfr1189 UTSW 2 88592655 missense probably damaging 1.00
R0565:Olfr1189 UTSW 2 88592009 missense probably benign 0.39
R1106:Olfr1189 UTSW 2 88592011 missense probably benign 0.01
R1501:Olfr1189 UTSW 2 88592148 missense possibly damaging 0.94
R1616:Olfr1189 UTSW 2 88592008 missense probably damaging 0.99
R1763:Olfr1189 UTSW 2 88592436 missense probably benign 0.02
R1989:Olfr1189 UTSW 2 88592599 missense probably damaging 0.99
R3436:Olfr1189 UTSW 2 88592104 missense probably damaging 1.00
R3500:Olfr1189 UTSW 2 88591941 missense probably damaging 1.00
R4410:Olfr1189 UTSW 2 88592421 missense probably benign 0.03
R4463:Olfr1189 UTSW 2 88592632 missense possibly damaging 0.77
R5005:Olfr1189 UTSW 2 88592004 missense probably benign 0.00
R5174:Olfr1189 UTSW 2 88592648 missense probably damaging 1.00
R5557:Olfr1189 UTSW 2 88592553 missense probably damaging 1.00
R6354:Olfr1189 UTSW 2 88592134 missense probably damaging 1.00
R6850:Olfr1189 UTSW 2 88592306 nonsense probably null
R7522:Olfr1189 UTSW 2 88592661 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAAGCCCTAGTCTGAGGTCAC -3'
(R):5'- GCCAGCTTCAGCAATGGAAAC -3'

Sequencing Primer
(F):5'- AGTCTGAGGTCACCCATGTAC -3'
(R):5'- GCTTCAGCAATGGAAACAAATC -3'
Posted On2014-06-23