Incidental Mutation 'R1883:Nipbl'
ID 209305
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4933421G18Rik, 4921518A06Rik
MMRRC Submission 039904-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R1883 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 8320101-8473947 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 8356616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Cysteine at position 1590 (F1590C)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000052965
AA Change: F1590C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: F1590C

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano9 T C 7: 140,682,244 (GRCm39) E677G probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Bhmt1b T C 18: 87,774,669 (GRCm39) L64P probably damaging Het
Brs3 T C X: 56,092,449 (GRCm39) I311T probably benign Het
Capn9 A G 8: 125,338,297 (GRCm39) K552R probably benign Het
Catsperg1 C T 7: 28,881,661 (GRCm39) probably null Het
Cdc16 A G 8: 13,825,738 (GRCm39) N449D probably damaging Het
Cdyl2 A T 8: 117,321,902 (GRCm39) N208K probably damaging Het
Cnot4 C T 6: 35,055,092 (GRCm39) V66I probably damaging Het
Cntn4 A G 6: 106,656,353 (GRCm39) T885A probably benign Het
Col20a1 C T 2: 180,634,703 (GRCm39) T131I possibly damaging Het
Crybg2 C A 4: 133,801,594 (GRCm39) S918* probably null Het
Dact2 A T 17: 14,418,085 (GRCm39) S207T possibly damaging Het
Dbnl G A 11: 5,749,247 (GRCm39) G356E probably benign Het
Ddx18 C A 1: 121,495,645 (GRCm39) probably benign Het
Dis3 A T 14: 99,328,905 (GRCm39) H282Q probably benign Het
Dnah3 T C 7: 119,677,142 (GRCm39) D453G probably benign Het
Dst T C 1: 34,228,389 (GRCm39) V1994A possibly damaging Het
Dusp8 C T 7: 141,638,085 (GRCm39) probably null Het
Eipr1 A T 12: 28,816,850 (GRCm39) H69L possibly damaging Het
Eml1 A G 12: 108,429,911 (GRCm39) R65G probably damaging Het
Epha7 C T 4: 28,950,362 (GRCm39) H722Y possibly damaging Het
Epyc A T 10: 97,511,695 (GRCm39) K229N possibly damaging Het
Extl1 A G 4: 134,091,917 (GRCm39) I312T probably benign Het
F13a1 G C 13: 37,172,981 (GRCm39) A133G probably benign Het
Fam185a G T 5: 21,630,242 (GRCm39) C26F possibly damaging Het
Fam186b T C 15: 99,176,679 (GRCm39) N737S probably damaging Het
Fam78b A G 1: 166,829,171 (GRCm39) I13V probably benign Het
Fat1 A T 8: 45,504,184 (GRCm39) Q4559L probably benign Het
Fnip1 T C 11: 54,406,373 (GRCm39) S1157P probably damaging Het
Foxj3 A C 4: 119,467,226 (GRCm39) M190L probably benign Het
Heatr3 T C 8: 88,871,221 (GRCm39) Y192H possibly damaging Het
Hexd T A 11: 121,098,524 (GRCm39) S3T probably benign Het
Klf3 C T 5: 64,980,224 (GRCm39) P5S probably damaging Het
Klf9 C T 19: 23,142,101 (GRCm39) S187L probably damaging Het
Krt9 T C 11: 100,079,523 (GRCm39) H623R unknown Het
Krtap2-4 G C 11: 99,505,505 (GRCm39) probably benign Het
Lmtk3 T C 7: 45,436,273 (GRCm39) Y84H probably damaging Het
Mroh3 G T 1: 136,134,731 (GRCm39) A166D probably damaging Het
Musk C A 4: 58,373,189 (GRCm39) P697T probably benign Het
Nek9 A G 12: 85,379,330 (GRCm39) L192P probably damaging Het
Nrk G T X: 137,907,922 (GRCm39) V1455F probably damaging Het
Nsun3 T C 16: 62,555,656 (GRCm39) D290G probably damaging Het
Obscn T C 11: 58,969,029 (GRCm39) T222A probably damaging Het
Or2a12 T C 6: 42,904,764 (GRCm39) S200P probably damaging Het
Or51f1d T C 7: 102,701,189 (GRCm39) I228T probably benign Het
Or6b9 T C 7: 106,555,981 (GRCm39) H54R probably benign Het
Osbpl11 T G 16: 33,034,723 (GRCm39) H237Q probably benign Het
Pde10a A T 17: 9,197,776 (GRCm39) T671S possibly damaging Het
Pkd2 A T 5: 104,631,094 (GRCm39) N506I probably damaging Het
Ppp3cb A G 14: 20,573,913 (GRCm39) V274A possibly damaging Het
Prex1 T C 2: 166,425,192 (GRCm39) D938G probably benign Het
Ptch1 G A 13: 63,659,841 (GRCm39) Q1134* probably null Het
Rasgrf2 A G 13: 92,117,149 (GRCm39) V820A probably benign Het
Rimbp2 C T 5: 128,880,998 (GRCm39) V137M possibly damaging Het
Rpa1 A G 11: 75,209,309 (GRCm39) V137A probably benign Het
Rps6ka1 A C 4: 133,591,354 (GRCm39) I299S probably damaging Het
Scn3b A C 9: 40,190,669 (GRCm39) probably null Het
Sdha A T 13: 74,481,255 (GRCm39) I317N probably damaging Het
Serpina1d T A 12: 103,732,037 (GRCm39) D274V possibly damaging Het
Sik3 C G 9: 46,132,387 (GRCm39) H1276Q probably benign Het
Snx14 T A 9: 88,284,314 (GRCm39) E451D probably benign Het
Spmip4 T C 6: 50,551,433 (GRCm39) T339A probably benign Het
Swt1 T A 1: 151,299,284 (GRCm39) K8* probably null Het
Tas1r3 G T 4: 155,946,610 (GRCm39) P332T probably damaging Het
Tas2r126 A T 6: 42,411,961 (GRCm39) T165S probably benign Het
Tecpr1 A G 5: 144,143,347 (GRCm39) V676A probably benign Het
Tg A G 15: 66,543,158 (GRCm39) E24G probably damaging Het
Tlr7 C T X: 166,089,468 (GRCm39) G673S probably benign Het
Tnxb T A 17: 34,908,539 (GRCm39) D1520E probably benign Het
Trabd A G 15: 88,966,184 (GRCm39) E47G probably damaging Het
Trim29 T A 9: 43,222,702 (GRCm39) I177N probably damaging Het
Ubxn2a A T 12: 4,944,563 (GRCm39) L53* probably null Het
Ulk2 A G 11: 61,721,438 (GRCm39) L208P probably damaging Het
Unc80 G A 1: 66,564,929 (GRCm39) C872Y possibly damaging Het
Vac14 A G 8: 111,438,319 (GRCm39) H644R probably damaging Het
Vmn1r20 C A 6: 57,409,306 (GRCm39) H211N probably benign Het
Vmn1r31 C T 6: 58,449,029 (GRCm39) V279I probably damaging Het
Vmn2r18 G T 5: 151,499,190 (GRCm39) Q425K probably benign Het
Vmn2r60 T C 7: 41,786,094 (GRCm39) V299A probably damaging Het
Vps54 A T 11: 21,262,967 (GRCm39) T685S possibly damaging Het
Vwa5b1 A G 4: 138,302,700 (GRCm39) W932R probably damaging Het
Wdr53 A T 16: 32,075,316 (GRCm39) I174F possibly damaging Het
Zfp157 A G 5: 138,443,102 (GRCm39) D31G probably damaging Het
Zfp60 T C 7: 27,449,435 (GRCm39) L701P probably benign Het
Zfp609 A T 9: 65,702,040 (GRCm39) M204K probably benign Het
Zfp831 A G 2: 174,545,870 (GRCm39) H1325R possibly damaging Het
Zfp995 A T 17: 22,099,622 (GRCm39) I204N probably benign Het
Zp2 C T 7: 119,732,624 (GRCm39) D641N probably benign Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8,396,157 (GRCm39) missense probably damaging 0.98
IGL00712:Nipbl APN 15 8,398,958 (GRCm39) missense probably damaging 0.97
IGL00789:Nipbl APN 15 8,326,353 (GRCm39) missense probably damaging 1.00
IGL01025:Nipbl APN 15 8,379,939 (GRCm39) missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8,379,981 (GRCm39) missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8,340,693 (GRCm39) missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8,380,023 (GRCm39) missense probably benign
IGL01723:Nipbl APN 15 8,364,555 (GRCm39) missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8,391,305 (GRCm39) missense probably benign 0.13
IGL02398:Nipbl APN 15 8,356,574 (GRCm39) missense probably damaging 1.00
IGL02437:Nipbl APN 15 8,388,558 (GRCm39) missense probably damaging 1.00
IGL02450:Nipbl APN 15 8,373,058 (GRCm39) missense probably damaging 0.99
IGL02477:Nipbl APN 15 8,353,131 (GRCm39) splice site probably null
IGL02547:Nipbl APN 15 8,381,082 (GRCm39) missense probably benign
IGL02678:Nipbl APN 15 8,380,594 (GRCm39) missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8,325,037 (GRCm39) missense probably benign 0.34
IGL03003:Nipbl APN 15 8,379,798 (GRCm39) missense probably damaging 1.00
IGL03117:Nipbl APN 15 8,361,936 (GRCm39) missense probably damaging 1.00
IGL03162:Nipbl APN 15 8,368,463 (GRCm39) missense probably benign 0.37
IGL03224:Nipbl APN 15 8,322,569 (GRCm39) missense probably damaging 0.98
IGL03339:Nipbl APN 15 8,380,360 (GRCm39) missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8,380,216 (GRCm39) missense probably benign
R3620_nipbl_616 UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R0271:Nipbl UTSW 15 8,391,221 (GRCm39) missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8,390,440 (GRCm39) missense probably damaging 0.99
R0347:Nipbl UTSW 15 8,380,216 (GRCm39) missense probably benign
R0422:Nipbl UTSW 15 8,381,112 (GRCm39) missense probably benign
R0486:Nipbl UTSW 15 8,368,354 (GRCm39) splice site probably benign
R0652:Nipbl UTSW 15 8,332,964 (GRCm39) missense probably benign 0.23
R0667:Nipbl UTSW 15 8,390,488 (GRCm39) missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8,322,562 (GRCm39) splice site probably null
R0726:Nipbl UTSW 15 8,381,039 (GRCm39) missense probably benign
R0881:Nipbl UTSW 15 8,337,096 (GRCm39) missense probably damaging 0.98
R0904:Nipbl UTSW 15 8,391,202 (GRCm39) missense probably benign
R0969:Nipbl UTSW 15 8,321,712 (GRCm39) missense probably damaging 1.00
R1401:Nipbl UTSW 15 8,401,657 (GRCm39) missense probably damaging 0.97
R1479:Nipbl UTSW 15 8,379,773 (GRCm39) missense probably benign 0.00
R1495:Nipbl UTSW 15 8,380,764 (GRCm39) missense probably benign 0.00
R1609:Nipbl UTSW 15 8,396,148 (GRCm39) missense probably damaging 1.00
R1679:Nipbl UTSW 15 8,332,396 (GRCm39) missense probably benign 0.31
R1756:Nipbl UTSW 15 8,368,035 (GRCm39) missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8,348,972 (GRCm39) missense probably damaging 1.00
R1835:Nipbl UTSW 15 8,373,001 (GRCm39) missense possibly damaging 0.80
R1914:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8,373,114 (GRCm39) missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8,379,771 (GRCm39) missense probably damaging 1.00
R2046:Nipbl UTSW 15 8,353,951 (GRCm39) missense probably benign 0.08
R2076:Nipbl UTSW 15 8,340,691 (GRCm39) missense probably benign 0.11
R2163:Nipbl UTSW 15 8,366,403 (GRCm39) missense probably damaging 0.99
R2170:Nipbl UTSW 15 8,322,702 (GRCm39) missense probably damaging 1.00
R2425:Nipbl UTSW 15 8,380,966 (GRCm39) missense probably benign 0.06
R2475:Nipbl UTSW 15 8,364,490 (GRCm39) missense probably benign 0.05
R2484:Nipbl UTSW 15 8,353,182 (GRCm39) missense probably damaging 0.99
R2970:Nipbl UTSW 15 8,340,723 (GRCm39) missense probably damaging 1.00
R3116:Nipbl UTSW 15 8,373,076 (GRCm39) missense probably benign 0.00
R3620:Nipbl UTSW 15 8,362,508 (GRCm39) missense probably damaging 0.99
R3725:Nipbl UTSW 15 8,325,145 (GRCm39) missense probably damaging 0.97
R3745:Nipbl UTSW 15 8,388,358 (GRCm39) missense probably benign
R3902:Nipbl UTSW 15 8,379,730 (GRCm39) missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8,380,018 (GRCm39) missense probably benign
R4164:Nipbl UTSW 15 8,368,418 (GRCm39) missense probably benign 0.24
R4246:Nipbl UTSW 15 8,361,916 (GRCm39) missense probably damaging 1.00
R4381:Nipbl UTSW 15 8,388,690 (GRCm39) missense probably benign 0.00
R4394:Nipbl UTSW 15 8,391,345 (GRCm39) missense probably benign 0.00
R4439:Nipbl UTSW 15 8,368,208 (GRCm39) missense probably damaging 0.98
R4440:Nipbl UTSW 15 8,396,142 (GRCm39) missense probably damaging 0.98
R4441:Nipbl UTSW 15 8,396,142 (GRCm39) missense probably damaging 0.98
R4672:Nipbl UTSW 15 8,332,468 (GRCm39) missense probably damaging 1.00
R4749:Nipbl UTSW 15 8,395,313 (GRCm39) missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8,380,981 (GRCm39) missense probably benign
R5428:Nipbl UTSW 15 8,359,780 (GRCm39) missense probably benign 0.00
R5641:Nipbl UTSW 15 8,396,196 (GRCm39) missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8,388,391 (GRCm39) missense probably benign
R5644:Nipbl UTSW 15 8,388,391 (GRCm39) missense probably benign
R5681:Nipbl UTSW 15 8,330,866 (GRCm39) missense probably benign 0.22
R5741:Nipbl UTSW 15 8,354,133 (GRCm39) missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8,364,328 (GRCm39) splice site probably null
R5970:Nipbl UTSW 15 8,326,302 (GRCm39) missense probably benign 0.27
R6041:Nipbl UTSW 15 8,353,748 (GRCm39) missense probably damaging 1.00
R6059:Nipbl UTSW 15 8,325,052 (GRCm39) missense probably damaging 1.00
R6213:Nipbl UTSW 15 8,364,390 (GRCm39) missense probably damaging 1.00
R6216:Nipbl UTSW 15 8,347,867 (GRCm39) missense probably damaging 0.99
R6236:Nipbl UTSW 15 8,354,064 (GRCm39) missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8,330,379 (GRCm39) missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8,330,268 (GRCm39) missense probably damaging 0.99
R6427:Nipbl UTSW 15 8,381,049 (GRCm39) missense probably benign
R6707:Nipbl UTSW 15 8,354,043 (GRCm39) missense probably benign 0.01
R6731:Nipbl UTSW 15 8,352,074 (GRCm39) missense probably damaging 1.00
R6921:Nipbl UTSW 15 8,332,969 (GRCm39) missense probably benign 0.28
R7239:Nipbl UTSW 15 8,321,619 (GRCm39) critical splice donor site probably null
R7346:Nipbl UTSW 15 8,373,090 (GRCm39) missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8,359,779 (GRCm39) missense probably benign 0.01
R7486:Nipbl UTSW 15 8,325,120 (GRCm39) missense probably benign 0.25
R7598:Nipbl UTSW 15 8,372,977 (GRCm39) missense probably benign 0.24
R7609:Nipbl UTSW 15 8,335,356 (GRCm39) missense probably benign 0.27
R7674:Nipbl UTSW 15 8,322,585 (GRCm39) missense probably benign 0.15
R7706:Nipbl UTSW 15 8,381,010 (GRCm39) missense probably benign 0.01
R7760:Nipbl UTSW 15 8,388,186 (GRCm39) missense probably damaging 1.00
R7766:Nipbl UTSW 15 8,326,333 (GRCm39) missense probably benign 0.45
R7825:Nipbl UTSW 15 8,320,971 (GRCm39) missense probably damaging 1.00
R7862:Nipbl UTSW 15 8,355,236 (GRCm39) missense probably benign 0.06
R7958:Nipbl UTSW 15 8,340,742 (GRCm39) missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8,340,734 (GRCm39) missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8,388,696 (GRCm39) missense probably benign 0.22
R8355:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8441:Nipbl UTSW 15 8,322,599 (GRCm39) missense probably benign 0.00
R8455:Nipbl UTSW 15 8,364,528 (GRCm39) missense probably damaging 0.98
R8717:Nipbl UTSW 15 8,368,225 (GRCm39) missense probably benign
R8739:Nipbl UTSW 15 8,332,904 (GRCm39) missense probably benign 0.08
R8854:Nipbl UTSW 15 8,330,210 (GRCm39) missense probably damaging 1.00
R8887:Nipbl UTSW 15 8,391,271 (GRCm39) missense probably damaging 1.00
R8942:Nipbl UTSW 15 8,381,104 (GRCm39) missense probably benign
R8991:Nipbl UTSW 15 8,320,997 (GRCm39) missense probably damaging 1.00
R9008:Nipbl UTSW 15 8,356,608 (GRCm39) missense probably damaging 1.00
R9070:Nipbl UTSW 15 8,368,215 (GRCm39) missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8,380,340 (GRCm39) missense probably benign 0.00
R9622:Nipbl UTSW 15 8,366,373 (GRCm39) missense probably benign 0.27
R9778:Nipbl UTSW 15 8,321,032 (GRCm39) missense probably benign 0.10
RF020:Nipbl UTSW 15 8,388,418 (GRCm39) missense probably damaging 0.98
X0022:Nipbl UTSW 15 8,381,199 (GRCm39) missense probably benign 0.05
X0027:Nipbl UTSW 15 8,353,021 (GRCm39) missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8,337,366 (GRCm39) missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8,368,183 (GRCm39) missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8,368,164 (GRCm39) critical splice donor site probably null
Z1177:Nipbl UTSW 15 8,366,436 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTAAATTAGACCCCGTCTC -3'
(R):5'- CATGGCACTTTTAAGTTCTCATAGTGC -3'

Sequencing Primer
(F):5'- TCTTTTTCCCACACCAAATGCAAAC -3'
(R):5'- CATAGTGCAATATAAGTAATGGAAAG -3'
Posted On 2014-06-30