Incidental Mutation 'R1885:Brip1'
ID209470
Institutional Source Beutler Lab
Gene Symbol Brip1
Ensembl Gene ENSMUSG00000034329
Gene NameBRCA1 interacting protein C-terminal helicase 1
Synonyms8030460J03Rik, 3110009N10Rik, BACH1
MMRRC Submission 039906-MU
Accession Numbers

Ncbi RefSeq: NM_178309.2; MGI:2442836

Is this an essential gene? Possibly essential (E-score: 0.715) question?
Stock #R1885 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location86058138-86201193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86138815 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 631 (G631V)
Ref Sequence ENSEMBL: ENSMUSP00000043108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044423]
Predicted Effect probably damaging
Transcript: ENSMUST00000044423
AA Change: G631V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043108
Gene: ENSMUSG00000034329
AA Change: G631V

DomainStartEndE-ValueType
DEXDc 17 520 1.4e-3 SMART
HELICc 701 854 8.2e-41 SMART
Coding Region Coverage
  • 1x: 97.0%
  • 3x: 96.1%
  • 10x: 92.7%
  • 20x: 85.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the DEAH subfamily of DEAD box helicases. A similar protein in humans is both a DNA-dependent ATPase and a 5-prime-to-3-prime DNA helicase, and plays a role in the repair of DNA double stranded breaks through interaction with the breast cancer-associated tumor suppressor BRCA1. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit gonadal atrophy, subfertility, germ cell attrition, epithelial tumor predisposition, increased cellular sensitivity to interstrand crosslink-inducing agents, hypersensitivity to replication inhibitors, and predisposition to lymphoma. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700102P08Rik T A 9: 108,393,610 D124E possibly damaging Het
Aarsd1 T C 11: 101,411,401 T278A probably benign Het
Acox2 C T 14: 8,248,102 M393I probably benign Het
Adcy10 A G 1: 165,570,808 I1491M probably benign Het
Adcy3 T A 12: 4,134,951 V209E probably damaging Het
Adora3 A C 3: 105,904,836 N13H possibly damaging Het
Ap2b1 T A 11: 83,390,735 N822K probably damaging Het
Apobec3 A T 15: 79,897,705 H82L probably damaging Het
Atg9b A T 5: 24,388,254 W384R probably damaging Het
Atp8a1 A G 5: 67,747,318 V506A possibly damaging Het
Atxn1 G T 13: 45,567,804 A205D probably benign Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B4galnt3 T C 6: 120,223,640 E223G probably damaging Het
C530008M17Rik A G 5: 76,856,742 T317A unknown Het
Cacna1i A G 15: 80,358,944 E434G probably damaging Het
Caprin2 A T 6: 148,877,885 probably null Het
Ccdc80 A C 16: 45,096,720 D613A probably benign Het
Ccdc81 T C 7: 89,866,611 E620G possibly damaging Het
Cebpz A T 17: 78,932,116 D625E probably benign Het
Coq6 C A 12: 84,372,464 N388K probably damaging Het
D430041D05Rik T C 2: 104,230,455 M1365V probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dap3 A G 3: 88,930,974 L86P probably damaging Het
Dpysl4 T G 7: 139,096,807 V391G probably damaging Het
Dyrk4 G T 6: 126,877,181 Q550K probably benign Het
Epas1 A G 17: 86,805,295 D107G probably damaging Het
Esrp2 A G 8: 106,131,821 V636A possibly damaging Het
Etl4 T A 2: 20,743,984 Y176N probably damaging Het
Etnppl T C 3: 130,629,462 V264A probably benign Het
Fer T A 17: 64,138,914 V790D probably damaging Het
Gdpd5 G A 7: 99,459,997 V575I probably benign Het
Gif G A 19: 11,752,324 A216T probably benign Het
Gipc3 T C 10: 81,341,347 I130V probably benign Het
Gm281 A C 14: 13,828,607 Y718D probably damaging Het
Iqsec3 G A 6: 121,428,367 probably benign Het
Kdm5d G T Y: 940,781 probably null Het
Kl A G 5: 150,953,494 R260G possibly damaging Het
Kras T C 6: 145,232,117 E143G probably damaging Het
Ksr1 C A 11: 79,020,378 V11F probably null Het
Ksr1 T C 11: 79,036,521 T329A probably damaging Het
March6 A G 15: 31,502,806 V83A probably benign Het
Mettl2 T C 11: 105,131,620 I212T possibly damaging Het
Mgat3 A G 15: 80,211,619 I216V probably benign Het
Mkrn3 G A 7: 62,418,738 A435V probably benign Het
Mlh1 C A 9: 111,258,556 S24I probably benign Het
Mmel1 G A 4: 154,890,876 R424Q possibly damaging Het
Mob3a G A 10: 80,691,234 Q86* probably null Het
Myh3 A G 11: 67,086,627 K368E probably benign Het
Myo16 T A 8: 10,322,656 N118K probably damaging Het
Myo5c A G 9: 75,249,761 S160G probably damaging Het
Nat1 A T 8: 67,491,001 I13F probably damaging Het
Ncoa7 T C 10: 30,648,452 N823S possibly damaging Het
Nwd1 T C 8: 72,704,994 S1207P probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1390 T C 11: 49,340,835 L101P probably damaging Het
Olfr153 T C 2: 87,532,824 S264P probably damaging Het
Olfr480 T C 7: 108,066,778 N7D probably benign Het
Paqr8 A T 1: 20,935,480 H286L probably damaging Het
Pdzd4 G A X: 73,795,446 R419C probably damaging Het
Pes1 A G 11: 3,969,482 K52E probably damaging Het
Ppp1r13l T C 7: 19,377,571 S774P probably damaging Het
Robo2 T C 16: 73,916,145 D1283G probably benign Het
Rp1l1 T C 14: 64,028,390 V475A probably benign Het
Scml4 A G 10: 42,912,227 Y51C probably damaging Het
Slc2a4 C T 11: 69,945,007 V339I probably benign Het
Slc39a6 G A 18: 24,601,482 probably null Het
Slco1b2 A T 6: 141,683,225 Y551F probably damaging Het
Snx33 T C 9: 56,925,837 H316R probably benign Het
Spata31d1a T G 13: 59,702,007 D769A probably damaging Het
Stmn2 A T 3: 8,541,904 E28V probably damaging Het
Syt9 A G 7: 107,436,529 D251G probably damaging Het
Tjap1 T C 17: 46,262,421 T37A probably damaging Het
Tmc7 A T 7: 118,561,087 F176I possibly damaging Het
Tprg A G 16: 25,412,891 T206A probably benign Het
Tsta3 G T 15: 75,926,989 T123N possibly damaging Het
Ttc37 A T 13: 76,113,047 R112S probably benign Het
Ttc37 A G 13: 76,130,235 Q556R probably benign Het
Ubqlnl A T 7: 104,150,065 M75K possibly damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r12 C T 5: 109,092,076 G207E probably damaging Het
Xrn2 T G 2: 147,049,361 L697* probably null Het
Zfp764 A G 7: 127,405,039 F307L probably benign Het
Zfp804b T C 5: 6,770,376 R860G probably damaging Het
Zranb2 A T 3: 157,543,156 probably null Het
Other mutations in Brip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Brip1 APN 11 86148401 missense possibly damaging 0.53
IGL01098:Brip1 APN 11 86108862 missense possibly damaging 0.71
IGL01503:Brip1 APN 11 86061877 missense probably benign 0.33
IGL01602:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01605:Brip1 APN 11 86062004 missense possibly damaging 0.53
IGL01940:Brip1 APN 11 86064966 missense probably benign 0.00
IGL02019:Brip1 APN 11 86197949 missense possibly damaging 0.73
IGL02212:Brip1 APN 11 86139015 missense possibly damaging 0.86
IGL02456:Brip1 APN 11 86065099 missense possibly damaging 0.71
IGL02727:Brip1 APN 11 86152736 missense probably benign 0.02
IGL02983:Brip1 APN 11 86139124 missense probably benign 0.03
IGL03022:Brip1 APN 11 86077950 missense probably damaging 0.98
IGL03116:Brip1 APN 11 86064909 nonsense probably null
IGL03143:Brip1 APN 11 86061827 missense possibly damaging 0.53
P0018:Brip1 UTSW 11 86108868 missense possibly damaging 0.51
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0011:Brip1 UTSW 11 86186998 missense possibly damaging 0.72
R0446:Brip1 UTSW 11 86157601 missense probably damaging 0.98
R0498:Brip1 UTSW 11 86197919 missense possibly damaging 0.96
R0599:Brip1 UTSW 11 86152737 missense probably benign
R0653:Brip1 UTSW 11 86152658 missense possibly damaging 0.85
R0661:Brip1 UTSW 11 86110363 missense possibly damaging 0.86
R0671:Brip1 UTSW 11 86152667 missense possibly damaging 0.93
R0718:Brip1 UTSW 11 86143305 missense possibly damaging 0.96
R0750:Brip1 UTSW 11 86061499 missense possibly damaging 0.53
R0834:Brip1 UTSW 11 86192827 missense probably benign
R1128:Brip1 UTSW 11 86064937 missense possibly damaging 0.86
R1726:Brip1 UTSW 11 86064914 missense probably benign 0.17
R1813:Brip1 UTSW 11 86187080 missense possibly damaging 0.53
R1886:Brip1 UTSW 11 86138815 missense probably damaging 1.00
R2093:Brip1 UTSW 11 86139145 missense possibly damaging 0.53
R2206:Brip1 UTSW 11 86061877 missense probably benign 0.33
R2207:Brip1 UTSW 11 86061877 missense probably benign 0.33
R3404:Brip1 UTSW 11 86143263 missense possibly damaging 0.96
R3421:Brip1 UTSW 11 86152669 nonsense probably null
R3876:Brip1 UTSW 11 86152790 missense probably damaging 0.98
R4018:Brip1 UTSW 11 86138851 missense possibly damaging 0.86
R4092:Brip1 UTSW 11 86148521 missense possibly damaging 0.92
R4384:Brip1 UTSW 11 86148429 missense possibly damaging 0.70
R4394:Brip1 UTSW 11 86074298 missense possibly damaging 0.85
R4518:Brip1 UTSW 11 86077878 missense possibly damaging 0.92
R4522:Brip1 UTSW 11 86189801 missense possibly damaging 0.49
R4840:Brip1 UTSW 11 86146183 missense possibly damaging 0.86
R5025:Brip1 UTSW 11 86064980 missense probably benign 0.04
R5176:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R5213:Brip1 UTSW 11 86143321 missense possibly damaging 0.73
R5470:Brip1 UTSW 11 86148542 missense possibly damaging 0.71
R5525:Brip1 UTSW 11 86110447 missense possibly damaging 0.85
R6057:Brip1 UTSW 11 86065039 missense possibly damaging 0.73
R6819:Brip1 UTSW 11 86110441 missense possibly damaging 0.51
R6908:Brip1 UTSW 11 86077884 missense probably damaging 0.98
R6920:Brip1 UTSW 11 86148536 nonsense probably null
X0060:Brip1 UTSW 11 86152619 missense possibly damaging 0.71
X0062:Brip1 UTSW 11 86143356 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ACCCTGTGAGTCTGTTAAGCAG -3'
(R):5'- TGCAACTTGTCTTGACTAGGACC -3'

Sequencing Primer
(F):5'- TGAGTCTGTTAAGCAGCTGAC -3'
(R):5'- TTGACTAGGACCAGAAATTAAATGGC -3'
Posted On2014-06-30