Incidental Mutation 'R1870:Gm5346'
ID210651
Institutional Source Beutler Lab
Gene Symbol Gm5346
Ensembl Gene ENSMUSG00000050190
Gene Namepredicted gene 5346
Synonyms
MMRRC Submission 039892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1870 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location43624951-43627276 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 43625095 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 697 (Y697*)
Ref Sequence ENSEMBL: ENSMUSP00000058858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056023]
Predicted Effect probably null
Transcript: ENSMUST00000056023
AA Change: Y697*
SMART Domains Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: Y697*

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 159 1.3e-18 PFAM
Pfam:Reprolysin_5 205 384 1.1e-15 PFAM
Pfam:Reprolysin_4 205 393 6.2e-9 PFAM
Pfam:Reprolysin 207 397 1.7e-46 PFAM
Pfam:Reprolysin_2 223 389 5.7e-14 PFAM
Pfam:Reprolysin_3 231 352 2.6e-13 PFAM
DISIN 416 491 2.48e-38 SMART
ACR 492 628 3.4e-65 SMART
EGF 634 664 2.69e1 SMART
transmembrane domain 685 707 N/A INTRINSIC
Meta Mutation Damage Score 0.6428 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 97% (96/99)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,418,007 E225G probably damaging Het
Abca13 A T 11: 9,292,134 E1332D probably benign Het
Abca5 C A 11: 110,329,217 V8L probably benign Het
Abcc8 C T 7: 46,123,915 E797K probably benign Het
Acd C A 8: 105,698,407 probably null Het
Adamts12 T C 15: 11,311,154 S1166P probably benign Het
AI481877 G A 4: 59,054,142 probably benign Het
Alox12b T C 11: 69,158,373 Y83H possibly damaging Het
Antxr2 A T 5: 98,030,438 S38T probably damaging Het
Aox1 A G 1: 58,076,103 E749G probably damaging Het
Arpc1a T A 5: 145,107,091 C344S possibly damaging Het
BC055324 G A 1: 163,964,794 L545F probably damaging Het
Bcan T C 3: 87,995,601 Y290C probably damaging Het
Bod1l G A 5: 41,833,675 S179F possibly damaging Het
Catsper3 A C 13: 55,805,748 D224A probably damaging Het
Ccar2 A G 14: 70,140,497 S680P probably damaging Het
Ccdc18 A G 5: 108,220,837 H1275R possibly damaging Het
Ccdc40 T C 11: 119,259,904 M1011T possibly damaging Het
Cfap46 T A 7: 139,683,470 D17V probably damaging Het
Csn1s2a T C 5: 87,778,199 F45L probably benign Het
Cwf19l2 T G 9: 3,458,802 N750K possibly damaging Het
Cyb5r4 A G 9: 87,040,409 D157G probably benign Het
D130040H23Rik T A 8: 69,302,702 I253N probably benign Het
Dennd4a C T 9: 64,897,234 A1285V probably benign Het
Dlat A G 9: 50,637,574 S561P probably damaging Het
Dlgap2 T A 8: 14,773,347 V522E probably damaging Het
Dnah5 T A 15: 28,331,713 Y2148* probably null Het
Dnase2a T C 8: 84,908,763 probably benign Het
Fam83f T C 15: 80,689,912 probably benign Het
Foxi1 A T 11: 34,207,937 N29K possibly damaging Het
Galk2 T C 2: 125,975,263 L324P probably benign Het
Gdpd4 G A 7: 97,972,955 V214I probably benign Het
Gfra3 C T 18: 34,711,320 A56T probably damaging Het
Glyctk A G 9: 106,155,348 S489P probably damaging Het
Gm884 T C 11: 103,620,605 D179G unknown Het
Izumo4 A T 10: 80,703,735 I135F probably damaging Het
Krt83 T A 15: 101,487,190 T342S probably benign Het
L1td1 T A 4: 98,737,477 D636E possibly damaging Het
Letm2 A G 8: 25,596,444 probably benign Het
Lpin1 A G 12: 16,541,743 F828L probably damaging Het
Mdn1 T A 4: 32,763,339 D5146E probably damaging Het
Megf10 T A 18: 57,191,185 Y99* probably null Het
Men1 A G 19: 6,337,630 D285G probably damaging Het
Mertk T G 2: 128,801,196 D838E probably benign Het
Mta1 T C 12: 113,128,074 S266P possibly damaging Het
Mta3 G A 17: 83,781,968 V320M probably damaging Het
Nlrp9c G A 7: 26,384,820 Q445* probably null Het
Olfr164 A T 16: 19,286,607 N45K probably damaging Het
Olfr558 T C 7: 102,709,754 I165T possibly damaging Het
Olfr885 A T 9: 38,061,350 K10I probably benign Het
Olfr974 T G 9: 39,942,821 I187R probably damaging Het
Pbrm1 T A 14: 31,106,175 L1320I probably damaging Het
Pdzd2 G T 15: 12,457,886 T297K probably damaging Het
Pfas T C 11: 68,991,969 D782G probably damaging Het
Pik3c3 T C 18: 30,293,132 probably null Het
Pira2 T C 7: 3,844,453 N79S probably damaging Het
Pkdrej G T 15: 85,816,431 T1768K probably damaging Het
Plcb3 T C 19: 6,962,985 I439V probably benign Het
Pold4 T A 19: 4,232,539 Y58* probably null Het
Ppef2 T G 5: 92,250,512 Q49P probably damaging Het
Ralgapa1 T A 12: 55,677,032 I2026F possibly damaging Het
Rest T A 5: 77,268,362 V141E possibly damaging Het
Rnf139 T C 15: 58,899,353 V409A probably benign Het
Rnpc3 T C 3: 113,611,055 probably benign Het
S100a10 A T 3: 93,561,070 E36V probably benign Het
S1pr3 A C 13: 51,419,916 K378Q probably benign Het
Scaper T A 9: 55,685,938 I472F probably damaging Het
Sgcg G A 14: 61,240,447 probably benign Het
Shank1 A T 7: 44,342,115 R69* probably null Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Slc25a54 T A 3: 109,080,616 Y24* probably null Het
Slc29a4 T C 5: 142,721,488 *529R probably null Het
Slc41a2 G A 10: 83,301,165 Q293* probably null Het
Slc4a7 T C 14: 14,737,509 probably null Het
Slfn9 G T 11: 82,981,576 T778N probably benign Het
Ssr2 T C 3: 88,576,642 probably benign Het
Tecrl T A 5: 83,354,859 T33S probably benign Het
Tnfrsf9 T A 4: 150,934,347 C158* probably null Het
Tradd T C 8: 105,259,160 E253G possibly damaging Het
Usp34 A G 11: 23,364,479 H807R probably benign Het
Vmn2r27 T C 6: 124,224,211 I262M probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps13a A G 19: 16,759,952 V91A probably damaging Het
Vwf C T 6: 125,642,939 R1527C probably damaging Het
Wwc1 C T 11: 35,861,945 G763D probably damaging Het
Zfp526 T G 7: 25,225,169 D284E possibly damaging Het
Zfp646 T C 7: 127,883,849 F1733L possibly damaging Het
Zfp90 A G 8: 106,419,123 H29R probably benign Het
Zkscan4 A G 13: 21,483,934 E185G probably benign Het
Other mutations in Gm5346
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gm5346 APN 8 43625381 missense probably benign 0.12
IGL00391:Gm5346 APN 8 43625629 missense probably damaging 1.00
IGL00422:Gm5346 APN 8 43626351 missense probably damaging 1.00
IGL00664:Gm5346 APN 8 43625969 missense probably benign
IGL01095:Gm5346 APN 8 43626096 missense probably benign 0.22
IGL01113:Gm5346 APN 8 43626152 missense probably damaging 1.00
IGL01444:Gm5346 APN 8 43626433 missense probably benign 0.06
IGL01782:Gm5346 APN 8 43626735 missense probably benign 0.01
IGL01921:Gm5346 APN 8 43625511 missense probably damaging 0.96
IGL01964:Gm5346 APN 8 43626761 missense probably benign 0.00
IGL02139:Gm5346 APN 8 43625578 missense probably benign 0.01
IGL02555:Gm5346 APN 8 43625268 missense probably damaging 1.00
IGL02951:Gm5346 APN 8 43627088 missense possibly damaging 0.62
R0056:Gm5346 UTSW 8 43625503 nonsense probably null
R0218:Gm5346 UTSW 8 43626440 missense probably benign 0.00
R0530:Gm5346 UTSW 8 43626531 missense probably benign 0.00
R0925:Gm5346 UTSW 8 43626303 missense probably benign 0.11
R0927:Gm5346 UTSW 8 43625123 missense probably benign 0.00
R0975:Gm5346 UTSW 8 43625118 missense probably benign
R1300:Gm5346 UTSW 8 43626844 nonsense probably null
R1728:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1729:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1801:Gm5346 UTSW 8 43625917 nonsense probably null
R1869:Gm5346 UTSW 8 43625095 nonsense probably null
R1871:Gm5346 UTSW 8 43625095 nonsense probably null
R1992:Gm5346 UTSW 8 43627139 missense probably benign 0.44
R2008:Gm5346 UTSW 8 43627037 missense probably benign 0.00
R2013:Gm5346 UTSW 8 43626405 missense possibly damaging 0.81
R2022:Gm5346 UTSW 8 43625917 nonsense probably null
R2175:Gm5346 UTSW 8 43625438 missense probably benign
R2875:Gm5346 UTSW 8 43627140 nonsense probably null
R3406:Gm5346 UTSW 8 43626052 nonsense probably null
R3845:Gm5346 UTSW 8 43626632 missense probably benign 0.00
R4033:Gm5346 UTSW 8 43626673 missense probably benign 0.28
R4072:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4074:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4075:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4076:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4153:Gm5346 UTSW 8 43626527 missense probably benign 0.04
R4330:Gm5346 UTSW 8 43626250 missense probably benign
R4612:Gm5346 UTSW 8 43626550 missense probably benign 0.09
R4662:Gm5346 UTSW 8 43627079 missense probably benign 0.26
R5032:Gm5346 UTSW 8 43626471 missense probably damaging 1.00
R5077:Gm5346 UTSW 8 43627163 missense possibly damaging 0.79
R5504:Gm5346 UTSW 8 43625282 missense probably damaging 1.00
R5697:Gm5346 UTSW 8 43626579 missense probably damaging 1.00
R6232:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6233:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6234:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6235:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6241:Gm5346 UTSW 8 43626096 missense probably benign 0.22
R6392:Gm5346 UTSW 8 43626001 missense probably benign 0.09
R6439:Gm5346 UTSW 8 43625951 missense probably damaging 1.00
R6454:Gm5346 UTSW 8 43626808 missense probably damaging 0.96
R6455:Gm5346 UTSW 8 43626152 missense probably damaging 1.00
R6767:Gm5346 UTSW 8 43626914 missense probably damaging 1.00
R6774:Gm5346 UTSW 8 43625183 missense probably benign 0.00
R6877:Gm5346 UTSW 8 43625237 missense probably benign 0.02
R6911:Gm5346 UTSW 8 43625109 missense probably benign 0.02
R7211:Gm5346 UTSW 8 43625877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACATTGACTGAAACGGG -3'
(R):5'- CATATGCAAGGAGTCTGCAAC -3'

Sequencing Primer
(F):5'- GGGGGAGAGGAGAGAGAGAG -3'
(R):5'- TATGCAAGGAGTCTGCAACAATAAAC -3'
Posted On2014-06-30