Incidental Mutation 'R1918:Cyp11a1'
ID212732
Institutional Source Beutler Lab
Gene Symbol Cyp11a1
Ensembl Gene ENSMUSG00000032323
Gene Namecytochrome P450, family 11, subfamily a, polypeptide 1
SynonymsCyp11a, cholesterol side chain cleavage, Scc, cscc, D9Ertd411e, P450scc
MMRRC Submission 039936-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1918 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58006411-58027023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58026757 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 496 (I496V)
Ref Sequence ENSEMBL: ENSMUSP00000034874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034874] [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000188539] [ENSMUST00000215944]
Predicted Effect probably damaging
Transcript: ENSMUST00000034874
AA Change: I496V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034874
Gene: ENSMUSG00000032323
AA Change: I496V

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
Pfam:p450 49 507 1.8e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042205
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098682
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119665
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144887
Predicted Effect probably benign
Transcript: ENSMUST00000188539
SMART Domains Protein: ENSMUSP00000140777
Gene: ENSMUSG00000032323

DomainStartEndE-ValueType
Pfam:p450 23 279 2.6e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188944
Predicted Effect probably benign
Transcript: ENSMUST00000215944
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are exhibit a steroid deficiency and die within days of birth showing signs of dehydration. Males are feminized with female external genitalia and underdeveloped gonads. Mice homozgyous for another knock-out allele exhibit abnormal adrenal development and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110035E14Rik T C 1: 9,601,627 F15S probably damaging Het
4930432E11Rik T G 7: 29,574,089 noncoding transcript Het
4930435E12Rik A G 16: 38,828,088 Y220H possibly damaging Het
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
A2m T C 6: 121,644,936 S314P probably benign Het
Abcc9 T A 6: 142,697,682 I47F probably damaging Het
Abcd2 C T 15: 91,191,481 R43H probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Aen C T 7: 78,906,029 H242Y possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap10 T C 8: 77,259,079 I698V probably benign Het
Arpp21 C T 9: 112,119,178 probably benign Het
Atp10a T C 7: 58,827,935 I1294T possibly damaging Het
Atp13a2 T C 4: 140,996,371 Y337H possibly damaging Het
BC147527 T C 13: 120,308,222 L26P probably damaging Het
Bsn C T 9: 108,107,573 G3094D unknown Het
Cadm2 G A 16: 66,747,384 probably benign Het
Cadps T C 14: 12,546,372 M495V probably damaging Het
Cass4 A G 2: 172,427,339 H447R possibly damaging Het
Ccdc124 C A 8: 70,868,944 R108L probably benign Het
Ccdc141 C T 2: 77,014,703 R1340Q probably benign Het
Ccdc148 T G 2: 58,982,899 R299S probably damaging Het
Ccdc36 T A 9: 108,412,985 H140L probably benign Het
Cd300lg A G 11: 102,054,110 E382G probably damaging Het
Cd36 A T 5: 17,797,036 C322* probably null Het
Celsr2 C T 3: 108,398,650 G2046D probably benign Het
Clasrp C T 7: 19,585,263 W492* probably null Het
Cmtr1 T C 17: 29,679,009 V154A possibly damaging Het
Ctnnb1 C T 9: 120,951,034 P128S possibly damaging Het
Disp2 G A 2: 118,791,927 V1047I probably benign Het
Eps8l2 T C 7: 141,361,724 V636A probably damaging Het
Fars2 T C 13: 36,204,546 L6P probably damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Fut8 G T 12: 77,332,218 R31L probably benign Het
G6pd2 T C 5: 61,810,321 F480L probably benign Het
Glipr1l2 T A 10: 112,092,645 C148* probably null Het
Gm10142 G A 10: 77,715,987 V61M probably benign Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm5134 T A 10: 75,976,346 M145K possibly damaging Het
Gm853 A T 4: 130,211,393 V328D probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpc2 T C 5: 138,278,379 T162A probably benign Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hal C T 10: 93,496,607 P294S probably damaging Het
Hectd3 C T 4: 117,000,343 A573V possibly damaging Het
Hephl1 T A 9: 15,076,818 I665F probably benign Het
Herc1 T C 9: 66,476,126 probably null Het
Hif1an A G 19: 44,571,112 probably null Het
Il12rb1 T A 8: 70,813,680 M223K probably benign Het
Ilf3 C T 9: 21,393,714 T201M probably damaging Het
Inpp5f T C 7: 128,663,969 probably benign Het
Jcad T C 18: 4,674,292 Y685H probably damaging Het
Kcnj1 C A 9: 32,396,738 Q153K probably benign Het
Kctd18 A C 1: 57,959,220 H73Q probably damaging Het
Klhl36 T A 8: 119,876,724 W573R probably damaging Het
Lepr A G 4: 101,772,836 T583A probably benign Het
Ltbp4 G A 7: 27,337,569 probably benign Het
Mapt A T 11: 104,298,499 E114D probably benign Het
Mib1 T A 18: 10,740,972 probably null Het
Mthfd1 G T 12: 76,314,976 A119S probably damaging Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nceh1 T G 3: 27,183,175 L33R probably damaging Het
Nfat5 T C 8: 107,366,236 I91T probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Oasl1 G A 5: 114,923,469 A20T possibly damaging Het
Olfr1262 T C 2: 90,002,574 F56S probably benign Het
Olfr141 C T 2: 86,806,827 M57I probably damaging Het
Olfr1428 A G 19: 12,109,507 V13A probably benign Het
Olfr1447 A G 19: 12,900,851 *310Q probably null Het
Olfr164 A T 16: 19,286,302 M147K probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pepd T C 7: 34,971,676 V215A probably benign Het
Pfkl A T 10: 78,001,426 N104K probably damaging Het
Phf24 T C 4: 42,938,165 probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Ppp1r13b A G 12: 111,834,810 V480A probably damaging Het
Ptgfrn A T 3: 101,056,307 I663N probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Rbm33 T A 5: 28,387,917 I605N probably damaging Het
Rps19bp1 T C 15: 80,264,079 T31A probably benign Het
Ryr2 T A 13: 11,556,698 T4885S possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skor2 T C 18: 76,859,356 S258P unknown Het
Slc22a29 C T 19: 8,217,759 probably null Het
Slc8a3 A T 12: 81,314,844 F400L probably damaging Het
Slc9a8 T C 2: 167,424,214 I37T possibly damaging Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spag5 A G 11: 78,304,176 N103S probably benign Het
Sptbn1 A T 11: 30,142,414 F450L probably damaging Het
Strn4 T A 7: 16,833,921 Y507N probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Syt17 G T 7: 118,433,985 L267I possibly damaging Het
Tdo2 T A 3: 81,958,940 R339W probably damaging Het
Ttn A G 2: 76,741,401 S26383P probably damaging Het
Ttn G T 2: 76,808,524 T13938K probably damaging Het
Tulp2 A G 7: 45,517,941 N188D possibly damaging Het
Ube3c C T 5: 29,587,317 R37C probably damaging Het
Uggt2 G T 14: 119,008,055 probably benign Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp17la C T 7: 104,860,746 T186I probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn1r235 T A 17: 21,262,397 I328K possibly damaging Het
Vmn2r50 A T 7: 10,047,683 S378R probably benign Het
Vwa2 C T 19: 56,908,934 T557I probably benign Het
Wdr60 A C 12: 116,232,601 S509A probably damaging Het
Yes1 G T 5: 32,684,735 Q534H probably benign Het
Zbtb25 A T 12: 76,349,301 Y382* probably null Het
Zc3h3 G A 15: 75,777,118 P722S probably damaging Het
Zfp36l2 T C 17: 84,186,736 T158A probably damaging Het
Zfp536 T C 7: 37,480,199 T994A probably damaging Het
Zfp592 C T 7: 81,037,420 Q824* probably null Het
Zfp629 C A 7: 127,612,000 K212N probably damaging Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Other mutations in Cyp11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Cyp11a1 APN 9 58019313 missense probably damaging 1.00
IGL01122:Cyp11a1 APN 9 58016306 missense probably damaging 1.00
IGL01993:Cyp11a1 APN 9 58020823 missense probably damaging 1.00
PIT4431001:Cyp11a1 UTSW 9 58016272 critical splice acceptor site probably null
R0347:Cyp11a1 UTSW 9 58016260 unclassified probably benign
R1446:Cyp11a1 UTSW 9 58015277 missense possibly damaging 0.95
R1774:Cyp11a1 UTSW 9 58018360 missense probably benign 0.05
R2935:Cyp11a1 UTSW 9 58016390 missense probably damaging 1.00
R3724:Cyp11a1 UTSW 9 58019322 missense probably benign 0.00
R4866:Cyp11a1 UTSW 9 58026097 missense probably damaging 1.00
R5301:Cyp11a1 UTSW 9 58019261 intron probably benign
R5718:Cyp11a1 UTSW 9 58018225 missense probably benign 0.00
R5787:Cyp11a1 UTSW 9 58015267 missense probably benign 0.03
R5988:Cyp11a1 UTSW 9 58020834 missense probably benign 0.01
R6044:Cyp11a1 UTSW 9 58026704 missense probably damaging 1.00
R6286:Cyp11a1 UTSW 9 58017418 intron probably benign
R6306:Cyp11a1 UTSW 9 58025100 missense probably benign 0.00
R6325:Cyp11a1 UTSW 9 58025568 missense probably benign
R6826:Cyp11a1 UTSW 9 58025087 missense probably damaging 0.97
R6931:Cyp11a1 UTSW 9 58025120 missense possibly damaging 0.77
R6960:Cyp11a1 UTSW 9 58018376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGCAGGGACCATTTAGAC -3'
(R):5'- CTGGGCAGGTAATCACAGAG -3'

Sequencing Primer
(F):5'- CCATTTAGACCACAGTCAAGAGGTTG -3'
(R):5'- CAGAGTGCTGTTTCTGAAGATAC -3'
Posted On2014-07-14