Incidental Mutation 'R1927:Dyx1c1'
ID214957
Institutional Source Beutler Lab
Gene Symbol Dyx1c1
Ensembl Gene ENSMUSG00000092192
Gene Namedyslexia susceptibility 1 candidate 1
Synonyms1700010I24Rik, b2b811Clo, EKN1
MMRRC Submission 039945-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R1927 (G1)
Quality Score198
Status Not validated
Chromosome9
Chromosomal Location72958785-72973064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72960627 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 57 (I57L)
Ref Sequence ENSEMBL: ENSMUSP00000034734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034734] [ENSMUST00000098567] [ENSMUST00000149692]
Predicted Effect probably damaging
Transcript: ENSMUST00000034734
AA Change: I57L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034734
Gene: ENSMUSG00000092192
AA Change: I57L

DomainStartEndE-ValueType
Pfam:CS 6 77 5.8e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
TPR 288 321 2.56e1 SMART
TPR 322 355 1.26e-1 SMART
TPR 364 397 2.59e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098567
AA Change: I57L

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000096166
Gene: ENSMUSG00000092192
AA Change: I57L

DomainStartEndE-ValueType
Pfam:CS 6 77 1.3e-14 PFAM
TPR 168 201 2.56e1 SMART
TPR 202 235 1.26e-1 SMART
TPR 244 277 2.59e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149692
AA Change: I57L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120629
Gene: ENSMUSG00000089865
AA Change: I57L

DomainStartEndE-ValueType
Pfam:CS 6 77 2.1e-9 PFAM
coiled coil region 101 161 N/A INTRINSIC
Pfam:TPR_11 286 352 2e-14 PFAM
Pfam:TPR_1 322 352 5.6e-6 PFAM
Blast:TPR 364 386 1e-5 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tetratricopeptide repeat domain-containing protein. The encoded protein interacts with estrogen receptors and the heat shock proteins, Hsp70 and Hsp90. An homologous protein in rat has been shown to function in neuronal migration in the developing neocortex. A chromosomal translocation involving this gene is associated with a susceptibility to developmental dyslexia. Mutations in this gene are associated with deficits in reading and spelling. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream cell cycle progression 1 (CCPG1) gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit both pre- and postnatal lethality, hydrocephalus, and defects in organ laterality and ciliary motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Eml1 C T 12: 108,538,217 R812* probably null Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Kdm4c C T 4: 74,345,483 T668I probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr1463 T C 19: 13,235,029 Y260H probably damaging Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Rtp1 T A 16: 23,431,209 I108N probably damaging Het
Sema6b A T 17: 56,132,797 F15I probably benign Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc22a29 A G 19: 8,207,066 I257T probably benign Het
Slc41a1 T C 1: 131,841,200 I256T probably damaging Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sorcs1 G T 19: 50,222,195 P744Q probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stat3 T C 11: 100,894,829 N465S probably damaging Het
Stmn2 T A 3: 8,545,576 M40K probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Znrf3 A G 11: 5,281,062 V817A probably benign Het
Other mutations in Dyx1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dyx1c1 APN 9 72969066 missense probably benign 0.02
R0211:Dyx1c1 UTSW 9 72961367 missense possibly damaging 0.82
R0310:Dyx1c1 UTSW 9 72972336 missense probably damaging 1.00
R0712:Dyx1c1 UTSW 9 72960657 nonsense probably null
R1791:Dyx1c1 UTSW 9 72960684 missense possibly damaging 0.90
R3085:Dyx1c1 UTSW 9 72972406 missense probably benign 0.00
R4624:Dyx1c1 UTSW 9 72964171 missense probably benign 0.01
R4998:Dyx1c1 UTSW 9 72960678 missense possibly damaging 0.93
R5008:Dyx1c1 UTSW 9 72972318 intron probably benign
R5200:Dyx1c1 UTSW 9 72972431 missense probably damaging 1.00
R5256:Dyx1c1 UTSW 9 72972080 critical splice donor site probably null
R5806:Dyx1c1 UTSW 9 72962054 missense probably benign 0.06
R5930:Dyx1c1 UTSW 9 72971998 missense probably damaging 1.00
R6751:Dyx1c1 UTSW 9 72961975 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACTATGTCCCCACCCTAGCATG -3'
(R):5'- AGGTACATACTGAGCTCTCGTG -3'

Sequencing Primer
(F):5'- CCCAGGTTGTCTACAAGAATAAGTGC -3'
(R):5'- ACATACTGAGCTCTCGTGAATGGC -3'
Posted On2014-07-14