Incidental Mutation 'R1933:Kcnab2'
ID215546
Institutional Source Beutler Lab
Gene Symbol Kcnab2
Ensembl Gene ENSMUSG00000028931
Gene Namepotassium voltage-gated channel, shaker-related subfamily, beta member 2
SynonymsKcnb3, I2rf5, F5, I2rf5
MMRRC Submission 039951-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.523) question?
Stock #R1933 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152390742-152477871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152435866 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 6 (T6A)
Ref Sequence ENSEMBL: ENSMUSP00000123939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030768] [ENSMUST00000105648] [ENSMUST00000159186] [ENSMUST00000159840] [ENSMUST00000160884] [ENSMUST00000161236] [ENSMUST00000162017]
Predicted Effect probably benign
Transcript: ENSMUST00000030768
AA Change: T6A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030768
Gene: ENSMUSG00000028931
AA Change: T6A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 37 342 1.6e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105648
AA Change: T6A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101273
Gene: ENSMUSG00000028931
AA Change: T6A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 356 7e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159186
AA Change: T6A

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124588
Gene: ENSMUSG00000028931
AA Change: T6A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 371 4.3e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159435
Predicted Effect probably benign
Transcript: ENSMUST00000159840
AA Change: T6A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124156
Gene: ENSMUSG00000028931
AA Change: T6A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 37 342 1.6e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160884
AA Change: T6A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000125058
Gene: ENSMUSG00000028931
AA Change: T6A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 356 7e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161236
AA Change: T6A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125270
Gene: ENSMUSG00000028931
AA Change: T6A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 134 4.9e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162017
AA Change: T6A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162200
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162518
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. This member alters functional properties of the KCNA4 gene product. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice show strain-specific changes in survival, body weight, thermoregulation and cold-swim induced tremors, impaired associative learning and memory, sporadic seizures and amygala hyperexcitability. Mice homozygous for a knock-in mutationshow no deficits in associative learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,885 Y396F probably benign Het
Adra2a T A 19: 54,046,406 F64L probably damaging Het
Ankrd45 A T 1: 161,151,300 N103I probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bsn A G 9: 108,116,444 V703A possibly damaging Het
Btaf1 T A 19: 36,972,957 I529K probably damaging Het
Ccdc110 A G 8: 45,943,250 N726S probably damaging Het
Ccdc78 T A 17: 25,787,070 S71T probably damaging Het
Cct5 G T 15: 31,591,008 Q516K probably benign Het
Cd300c2 A T 11: 115,000,859 V63E probably benign Het
Cdh16 A G 8: 104,617,963 V7A possibly damaging Het
Clec16a T C 16: 10,688,539 F710L probably damaging Het
Clpb T G 7: 101,779,211 F393V probably damaging Het
Commd9 G A 2: 101,901,031 R187H probably damaging Het
Crx T A 7: 15,868,376 K126* probably null Het
Dcaf13 T A 15: 39,138,088 Y264N probably damaging Het
Dnah12 T A 14: 26,734,495 I791N probably damaging Het
Dpy19l1 A T 9: 24,434,387 D456E probably damaging Het
Dscam A G 16: 96,593,214 S1963P probably benign Het
Efl1 C T 7: 82,763,117 Q905* probably null Het
Fam57b T A 7: 126,827,672 probably null Het
Farsa T C 8: 84,861,151 F104L probably benign Het
Fbxl19 C A 7: 127,750,929 A231E probably benign Het
Fbxw19 A T 9: 109,481,650 N401K probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Frem3 A G 8: 80,612,890 N604S probably benign Het
Gad1 T G 2: 70,587,392 C312G possibly damaging Het
Garem2 G T 5: 30,114,862 E441* probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm8206 A T 14: 6,022,475 M8K probably benign Het
Gpr162 G A 6: 124,861,447 S80F probably damaging Het
Grpr C A X: 163,549,141 V53L probably benign Het
Il21 C T 3: 37,232,486 R27H probably benign Het
Il21r C T 7: 125,628,981 T208I possibly damaging Het
Klra4 T A 6: 130,065,244 Q20L possibly damaging Het
Lrrtm1 A T 6: 77,244,966 probably null Het
Lrrtm3 A G 10: 64,088,513 F292L possibly damaging Het
Mpeg1 A T 19: 12,462,647 K490* probably null Het
Myh14 C T 7: 44,615,348 M1671I probably benign Het
Nebl A T 2: 17,375,292 M757K probably damaging Het
Olfr1110 T A 2: 87,135,844 H159L probably damaging Het
Olfr504 A C 7: 108,565,523 F91V possibly damaging Het
Olfr631 G T 7: 103,929,130 M102I probably damaging Het
Pkhd1l1 A T 15: 44,540,884 H2303L possibly damaging Het
Podxl2 C T 6: 88,849,605 V240M probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prss53 T C 7: 127,886,262 *553W probably null Het
Psma3 T A 12: 70,984,694 M43K probably benign Het
Rad50 G T 11: 53,680,061 T790K probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Rpn1 T A 6: 88,093,859 V237E probably damaging Het
Scn10a T A 9: 119,609,998 M1601L probably damaging Het
Sema4f G T 6: 82,930,927 P180Q probably damaging Het
Serpinb5 A G 1: 106,876,121 E8G probably damaging Het
Sgcg C T 14: 61,232,412 V167I possibly damaging Het
Slc25a13 C T 6: 6,109,262 V367M probably damaging Het
Spata31 T C 13: 64,920,610 S191P probably benign Het
Srbd1 A G 17: 86,102,893 V537A probably damaging Het
Srgap1 G T 10: 121,925,903 D113E possibly damaging Het
Srl A G 16: 4,492,350 I505T probably damaging Het
St14 G A 9: 31,106,212 T226I probably benign Het
Stard9 T A 2: 120,698,656 I1798N possibly damaging Het
Sugp1 A G 8: 70,056,575 E166G possibly damaging Het
Susd1 A T 4: 59,351,695 N455K possibly damaging Het
Sytl3 T A 17: 6,733,046 V205E probably damaging Het
Tenm4 A G 7: 96,895,326 Y2183C probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tlr1 T G 5: 64,925,438 T599P possibly damaging Het
Trpc6 G A 9: 8,656,545 D658N probably damaging Het
Ttc39b A G 4: 83,232,720 V546A possibly damaging Het
Ube3c T C 5: 29,619,659 Y561H probably damaging Het
Vmn1r29 T A 6: 58,307,420 S42T probably benign Het
Vps4a T C 8: 107,044,558 V392A probably benign Het
Wdfy4 T C 14: 33,133,344 E771G probably benign Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Wnt5a C T 14: 28,511,845 P10L probably benign Het
Zfhx2 T C 14: 55,075,238 probably benign Het
Zfp451 T C 1: 33,777,822 K132R probably damaging Het
Other mutations in Kcnab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Kcnab2 APN 4 152393797 missense possibly damaging 0.94
IGL02201:Kcnab2 APN 4 152401918 unclassified probably benign
IGL02449:Kcnab2 APN 4 152411984 critical splice donor site probably null
IGL02957:Kcnab2 APN 4 152435869 missense possibly damaging 0.62
R0415:Kcnab2 UTSW 4 152395136 missense probably benign 0.39
R0485:Kcnab2 UTSW 4 152394982 missense probably benign
R1759:Kcnab2 UTSW 4 152393052 missense probably damaging 0.99
R3037:Kcnab2 UTSW 4 152393756 missense possibly damaging 0.94
R3913:Kcnab2 UTSW 4 152395232 missense probably damaging 0.99
R4178:Kcnab2 UTSW 4 152404601 missense probably null 1.00
R4863:Kcnab2 UTSW 4 152401946 missense probably damaging 1.00
R4919:Kcnab2 UTSW 4 152401940 missense probably damaging 1.00
R5996:Kcnab2 UTSW 4 152434830 splice site probably null
R6519:Kcnab2 UTSW 4 152411993 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGTAGCCTCAGATGACATTGTG -3'
(R):5'- CAGTGGAGAGATGGGATCTTCC -3'

Sequencing Primer
(F):5'- AGCCTCAGATGACATTGTGTACGTC -3'
(R):5'- ATGGGATCTTCCTCAGTGGCC -3'
Posted On2014-07-14