Incidental Mutation 'R1933:Dnah12'
ID215610
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission 039951-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.532) question?
Stock #R1933 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26734495 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 791 (I791N)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect probably damaging
Transcript: ENSMUST00000022433
AA Change: I791N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: I791N

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,885 Y396F probably benign Het
Adra2a T A 19: 54,046,406 F64L probably damaging Het
Ankrd45 A T 1: 161,151,300 N103I probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bsn A G 9: 108,116,444 V703A possibly damaging Het
Btaf1 T A 19: 36,972,957 I529K probably damaging Het
Ccdc110 A G 8: 45,943,250 N726S probably damaging Het
Ccdc78 T A 17: 25,787,070 S71T probably damaging Het
Cct5 G T 15: 31,591,008 Q516K probably benign Het
Cd300c2 A T 11: 115,000,859 V63E probably benign Het
Cdh16 A G 8: 104,617,963 V7A possibly damaging Het
Clec16a T C 16: 10,688,539 F710L probably damaging Het
Clpb T G 7: 101,779,211 F393V probably damaging Het
Commd9 G A 2: 101,901,031 R187H probably damaging Het
Crx T A 7: 15,868,376 K126* probably null Het
Dcaf13 T A 15: 39,138,088 Y264N probably damaging Het
Dpy19l1 A T 9: 24,434,387 D456E probably damaging Het
Dscam A G 16: 96,593,214 S1963P probably benign Het
Efl1 C T 7: 82,763,117 Q905* probably null Het
Fam57b T A 7: 126,827,672 probably null Het
Farsa T C 8: 84,861,151 F104L probably benign Het
Fbxl19 C A 7: 127,750,929 A231E probably benign Het
Fbxw19 A T 9: 109,481,650 N401K probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Frem3 A G 8: 80,612,890 N604S probably benign Het
Gad1 T G 2: 70,587,392 C312G possibly damaging Het
Garem2 G T 5: 30,114,862 E441* probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm8206 A T 14: 6,022,475 M8K probably benign Het
Gpr162 G A 6: 124,861,447 S80F probably damaging Het
Grpr C A X: 163,549,141 V53L probably benign Het
Il21 C T 3: 37,232,486 R27H probably benign Het
Il21r C T 7: 125,628,981 T208I possibly damaging Het
Kcnab2 T C 4: 152,435,866 T6A possibly damaging Het
Klra4 T A 6: 130,065,244 Q20L possibly damaging Het
Lrrtm1 A T 6: 77,244,966 probably null Het
Lrrtm3 A G 10: 64,088,513 F292L possibly damaging Het
Mpeg1 A T 19: 12,462,647 K490* probably null Het
Myh14 C T 7: 44,615,348 M1671I probably benign Het
Nebl A T 2: 17,375,292 M757K probably damaging Het
Olfr1110 T A 2: 87,135,844 H159L probably damaging Het
Olfr504 A C 7: 108,565,523 F91V possibly damaging Het
Olfr631 G T 7: 103,929,130 M102I probably damaging Het
Pkhd1l1 A T 15: 44,540,884 H2303L possibly damaging Het
Podxl2 C T 6: 88,849,605 V240M probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prss53 T C 7: 127,886,262 *553W probably null Het
Psma3 T A 12: 70,984,694 M43K probably benign Het
Rad50 G T 11: 53,680,061 T790K probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Rpn1 T A 6: 88,093,859 V237E probably damaging Het
Scn10a T A 9: 119,609,998 M1601L probably damaging Het
Sema4f G T 6: 82,930,927 P180Q probably damaging Het
Serpinb5 A G 1: 106,876,121 E8G probably damaging Het
Sgcg C T 14: 61,232,412 V167I possibly damaging Het
Slc25a13 C T 6: 6,109,262 V367M probably damaging Het
Spata31 T C 13: 64,920,610 S191P probably benign Het
Srbd1 A G 17: 86,102,893 V537A probably damaging Het
Srgap1 G T 10: 121,925,903 D113E possibly damaging Het
Srl A G 16: 4,492,350 I505T probably damaging Het
St14 G A 9: 31,106,212 T226I probably benign Het
Stard9 T A 2: 120,698,656 I1798N possibly damaging Het
Sugp1 A G 8: 70,056,575 E166G possibly damaging Het
Susd1 A T 4: 59,351,695 N455K possibly damaging Het
Sytl3 T A 17: 6,733,046 V205E probably damaging Het
Tenm4 A G 7: 96,895,326 Y2183C probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tlr1 T G 5: 64,925,438 T599P possibly damaging Het
Trpc6 G A 9: 8,656,545 D658N probably damaging Het
Ttc39b A G 4: 83,232,720 V546A possibly damaging Het
Ube3c T C 5: 29,619,659 Y561H probably damaging Het
Vmn1r29 T A 6: 58,307,420 S42T probably benign Het
Vps4a T C 8: 107,044,558 V392A probably benign Het
Wdfy4 T C 14: 33,133,344 E771G probably benign Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Wnt5a C T 14: 28,511,845 P10L probably benign Het
Zfhx2 T C 14: 55,075,238 probably benign Het
Zfp451 T C 1: 33,777,822 K132R probably damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site unknown
R7108:Dnah12 UTSW 14 26778912 critical splice donor site unknown
R7121:Dnah12 UTSW 14 26778912 critical splice donor site unknown
R7122:Dnah12 UTSW 14 26778912 critical splice donor site unknown
R7135:Dnah12 UTSW 14 26778912 critical splice donor site unknown
R7135:Dnah12 UTSW 14 26801413 missense not run
R7150:Dnah12 UTSW 14 26861732 missense not run
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACATTGGCGATGAACTTTGGAATAC -3'
(R):5'- GAACAAACCCCTCAAGTGTTTC -3'

Sequencing Primer
(F):5'- GCGATGAACTTTGGAATACTTTTG -3'
(R):5'- AAACCCCTCAAGTGTTTCATTTTATC -3'
Posted On2014-07-14