Incidental Mutation 'R0057:Top3a'
ID216076
Institutional Source Beutler Lab
Gene Symbol Top3a
Ensembl Gene ENSMUSG00000002814
Gene Nametopoisomerase (DNA) III alpha
SynonymsTop IIIa
MMRRC Submission 038351-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0057 (G1)
Quality Score49
Status Validated
Chromosome11
Chromosomal Location60740058-60777365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60740684 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 951 (A951T)
Ref Sequence ENSEMBL: ENSMUSP00000002891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002891] [ENSMUST00000102668] [ENSMUST00000117743] [ENSMUST00000120417]
Predicted Effect probably benign
Transcript: ENSMUST00000002891
AA Change: A951T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002891
Gene: ENSMUSG00000002814
AA Change: A951T

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 1.7e-15 PFAM
Pfam:zf-GRF 813 854 9.7e-23 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 7.9e-24 PFAM
ZnF_C2HC 985 1001 7.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102668
SMART Domains Protein: ENSMUSP00000099729
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 5.9e-16 PFAM
Pfam:zf-GRF 813 854 2.6e-21 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117743
SMART Domains Protein: ENSMUSP00000113057
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 669 4.6e-16 PFAM
ZnF_C2HC 755 771 7.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120417
SMART Domains Protein: ENSMUSP00000113653
Gene: ENSMUSG00000002814

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 666 1.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158956
Meta Mutation Damage Score 0.1416 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus reducing the number of supercoils and altering the topology of DNA. This enzyme forms a complex with BLM which functions in the regulation of recombination in somatic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele die shortly after implantation and the induction of decidual reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,570,919 H693Q probably damaging Het
Ap5z1 T C 5: 142,470,389 probably benign Het
Bloc1s6 T A 2: 122,744,221 probably benign Het
Caskin1 A G 17: 24,504,896 N886S probably damaging Het
Ctse G T 1: 131,663,371 D97Y probably damaging Het
Dcaf11 T C 14: 55,569,310 V490A probably benign Het
Dctn1 A G 6: 83,179,892 H7R probably benign Het
Dscam A C 16: 96,673,736 W1209G probably damaging Het
Fuk C T 8: 110,893,768 probably benign Het
Gna11 A G 10: 81,530,940 M312T probably benign Het
Hacd2 T A 16: 35,075,627 V105D probably damaging Het
Htra4 C A 8: 25,038,808 V23L probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Msh4 C T 3: 153,869,681 A686T probably benign Het
Nbas T A 12: 13,390,957 M1096K probably benign Het
Olfr1022 C A 2: 85,869,253 Y220* probably null Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prlr A G 15: 10,328,423 Y328C probably damaging Het
Ros1 C T 10: 52,180,191 V68I probably benign Het
Shmt2 G A 10: 127,521,048 T31M possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Tas2r135 A G 6: 42,406,420 T298A probably benign Het
Tmem175 C T 5: 108,639,562 H92Y probably damaging Het
Trpc4ap T C 2: 155,640,486 E528G possibly damaging Het
Trpm6 T C 19: 18,786,755 C242R probably benign Het
Vwa7 G A 17: 35,024,547 S710N possibly damaging Het
Zfa-ps A T 10: 52,545,106 noncoding transcript Het
Zfp770 T A 2: 114,197,232 R119* probably null Het
Other mutations in Top3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Top3a APN 11 60761736 missense probably damaging 1.00
IGL02935:Top3a APN 11 60762528 missense possibly damaging 0.53
R0057:Top3a UTSW 11 60740684 missense probably benign
R0369:Top3a UTSW 11 60742789 missense probably damaging 1.00
R1171:Top3a UTSW 11 60750593 missense probably benign 0.02
R1459:Top3a UTSW 11 60759362 missense probably damaging 1.00
R1621:Top3a UTSW 11 60750607 missense probably damaging 1.00
R1812:Top3a UTSW 11 60759362 missense probably damaging 1.00
R1839:Top3a UTSW 11 60753888 missense probably damaging 1.00
R1873:Top3a UTSW 11 60747984 nonsense probably null
R2004:Top3a UTSW 11 60742489 missense probably damaging 0.99
R2277:Top3a UTSW 11 60745874 missense possibly damaging 0.95
R2406:Top3a UTSW 11 60756012 missense probably damaging 1.00
R2418:Top3a UTSW 11 60748016 missense possibly damaging 0.95
R3196:Top3a UTSW 11 60759356 missense probably damaging 1.00
R3879:Top3a UTSW 11 60743939 missense possibly damaging 0.92
R4695:Top3a UTSW 11 60742412 missense probably benign 0.40
R4715:Top3a UTSW 11 60742997 nonsense probably null
R4768:Top3a UTSW 11 60762490 missense probably damaging 1.00
R4910:Top3a UTSW 11 60752378 splice site probably benign
R5305:Top3a UTSW 11 60762539 missense possibly damaging 0.56
R5387:Top3a UTSW 11 60762490 missense probably damaging 1.00
R5419:Top3a UTSW 11 60762522 missense probably damaging 1.00
R5806:Top3a UTSW 11 60776920 critical splice donor site probably null
R6162:Top3a UTSW 11 60745937 missense probably damaging 1.00
R6279:Top3a UTSW 11 60749408 missense probably benign 0.02
R6300:Top3a UTSW 11 60749408 missense probably benign 0.02
R6381:Top3a UTSW 11 60744023 missense probably damaging 1.00
R6383:Top3a UTSW 11 60749459 missense probably benign 0.30
R6767:Top3a UTSW 11 60750753 missense possibly damaging 0.84
R6919:Top3a UTSW 11 60749493 missense probably damaging 1.00
R7299:Top3a UTSW 11 60748148 missense probably damaging 0.99
R7301:Top3a UTSW 11 60748148 missense probably damaging 0.99
X0063:Top3a UTSW 11 60750644 nonsense probably null
X0065:Top3a UTSW 11 60763398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTTCCATCAGTGCAGCAGCC -3'
(R):5'- CCTGCCTTGTGAAAGTTGACACCTC -3'

Sequencing Primer
(F):5'- CTAGGTTTCCAGGACAGTGC -3'
(R):5'- ATtttggttttgtttgagacatagtc -3'
Posted On2014-07-21