Incidental Mutation 'R0134:Hps1'
ID21846
Institutional Source Beutler Lab
Gene Symbol Hps1
Ensembl Gene ENSMUSG00000025188
Gene NameHPS1, biogenesis of lysosomal organelles complex 3 subunit 1
Synonyms6030422N11Rik
MMRRC Submission 038419-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R0134 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location42755105-42779978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42766180 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 277 (Q277K)
Ref Sequence ENSEMBL: ENSMUSP00000124209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026194] [ENSMUST00000069298] [ENSMUST00000160455] [ENSMUST00000162004] [ENSMUST00000162061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026194
AA Change: Q277K

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026194
Gene: ENSMUSG00000025188
AA Change: Q277K

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069298
AA Change: Q285K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071069
Gene: ENSMUSG00000025188
AA Change: Q285K

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159974
Predicted Effect possibly damaging
Transcript: ENSMUST00000160455
AA Change: Q285K

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125662
Gene: ENSMUSG00000025188
AA Change: Q285K

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161761
Predicted Effect possibly damaging
Transcript: ENSMUST00000162004
AA Change: Q277K

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125226
Gene: ENSMUSG00000025188
AA Change: Q277K

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162061
AA Change: Q277K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124209
Gene: ENSMUSG00000025188
AA Change: Q277K

DomainStartEndE-ValueType
coiled coil region 20 47 N/A INTRINSIC
low complexity region 229 246 N/A INTRINSIC
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is a component of three different protein complexes termed biogenesis of lysosome-related organelles complex (BLOC)-3, BLOC4, and BLOC5. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 1. Alternative splicing results in multiple transcript variants. A pseudogene related to this gene is located on chromosome 22. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit hypopigmentation and increased bleeding time. Impaired natural killer cell function, reduced secretion of kidney lysosomal enzymes,and abnormal retinofugal neuronal projections characterize some alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik G A 18: 38,261,264 V505I probably benign Het
1110059E24Rik T C 19: 21,598,201 probably benign Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Arhgap23 G T 11: 97,444,328 V70L probably benign Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cd59b G A 2: 104,078,941 probably null Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Esyt2 A G 12: 116,367,710 N736S probably damaging Het
Exoc4 A G 6: 33,971,946 D908G possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hes1 T C 16: 30,067,250 V224A probably damaging Het
Ighv15-2 T G 12: 114,565,037 probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgae A C 11: 73,111,342 M91L probably benign Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lipo4 A G 19: 33,501,606 V278A probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Map9 G A 3: 82,359,983 probably benign Het
Miox C T 15: 89,334,454 probably benign Het
Mndal A T 1: 173,857,513 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Pdgfra A G 5: 75,166,511 D123G probably damaging Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Prickle1 A G 15: 93,510,777 L47P possibly damaging Het
Ptar1 T A 19: 23,718,095 C309S probably benign Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Siglecg G A 7: 43,411,171 G325D probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Smyd1 G T 6: 71,216,765 T392N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp518b A G 5: 38,674,659 M1T probably null Het
Other mutations in Hps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Hps1 APN 19 42771129 nonsense probably null
IGL02327:Hps1 APN 19 42756345 unclassified probably benign
IGL02488:Hps1 APN 19 42757788 unclassified probably benign
IGL03161:Hps1 APN 19 42767271 missense probably damaging 1.00
R0127:Hps1 UTSW 19 42771111 splice site probably benign
R0234:Hps1 UTSW 19 42762553 missense probably damaging 1.00
R0234:Hps1 UTSW 19 42762553 missense probably damaging 1.00
R0394:Hps1 UTSW 19 42770899 splice site probably null
R1435:Hps1 UTSW 19 42762275 missense probably benign 0.04
R1537:Hps1 UTSW 19 42759704 critical splice donor site probably null
R1616:Hps1 UTSW 19 42767185 missense probably damaging 1.00
R1860:Hps1 UTSW 19 42762449 missense probably damaging 1.00
R2014:Hps1 UTSW 19 42762512 missense probably benign 0.00
R3424:Hps1 UTSW 19 42760513 missense possibly damaging 0.75
R4472:Hps1 UTSW 19 42762496 missense probably damaging 1.00
R5476:Hps1 UTSW 19 42769602 splice site probably null
R6054:Hps1 UTSW 19 42770778 missense probably damaging 0.96
R6275:Hps1 UTSW 19 42769607 missense probably null 1.00
R6807:Hps1 UTSW 19 42770778 missense possibly damaging 0.60
R6916:Hps1 UTSW 19 42766725
Predicted Primers PCR Primer
(F):5'- ACATTAGATGCCAGGCAGCCTCTC -3'
(R):5'- TGTCAGCCTTGCCACACTATCG -3'

Sequencing Primer
(F):5'- GCCTCTCCCAACAGGTTCAG -3'
(R):5'- ATCGTATGTCATCAGTGATGCCAG -3'
Posted On2013-04-12