Incidental Mutation 'R1974:Mfrp'
ID221431
Institutional Source Beutler Lab
Gene Symbol Mfrp
Ensembl Gene ENSMUSG00000034739
Gene Namemembrane frizzled-related protein
Synonyms
MMRRC Submission 039987-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R1974 (G1)
Quality Score181
Status Not validated
Chromosome9
Chromosomal Location44101729-44109187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44106372 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 554 (C554R)
Ref Sequence ENSEMBL: ENSMUSP00000145676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034654] [ENSMUST00000056328] [ENSMUST00000065379] [ENSMUST00000114815] [ENSMUST00000114816] [ENSMUST00000114818] [ENSMUST00000114821] [ENSMUST00000152956] [ENSMUST00000161381] [ENSMUST00000161703] [ENSMUST00000162126] [ENSMUST00000185479] [ENSMUST00000205282] [ENSMUST00000205500] [ENSMUST00000206295] [ENSMUST00000206308] [ENSMUST00000206769] [ENSMUST00000215685] [ENSMUST00000216511]
Predicted Effect probably damaging
Transcript: ENSMUST00000034654
AA Change: C554R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034654
Gene: ENSMUSG00000034739
AA Change: C554R

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 471 577 3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056328
SMART Domains Protein: ENSMUSP00000110478
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065379
SMART Domains Protein: ENSMUSP00000070060
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114815
SMART Domains Protein: ENSMUSP00000110463
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114816
SMART Domains Protein: ENSMUSP00000110464
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114818
SMART Domains Protein: ENSMUSP00000110466
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 235 2.09e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114821
SMART Domains Protein: ENSMUSP00000110469
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 47 91 N/A INTRINSIC
C1Q 97 220 1.01e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152956
SMART Domains Protein: ENSMUSP00000123040
Gene: ENSMUSG00000079592

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Collagen 28 102 7.2e-10 PFAM
Pfam:C1q 105 138 1.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160985
SMART Domains Protein: ENSMUSP00000124568
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
RING 11 52 1.57e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161381
AA Change: C548R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124456
Gene: ENSMUSG00000034739
AA Change: C548R

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
CUB 307 420 1.85e-37 SMART
Pfam:Fz 465 576 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161703
SMART Domains Protein: ENSMUSP00000125053
Gene: ENSMUSG00000034739

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
CUB 150 259 3.6e-35 SMART
LDLa 265 302 1.5e-8 SMART
LDLa 307 342 2.09e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162126
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174014
Predicted Effect probably benign
Transcript: ENSMUST00000185479
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205282
Predicted Effect probably benign
Transcript: ENSMUST00000205500
Predicted Effect probably benign
Transcript: ENSMUST00000206295
Predicted Effect probably damaging
Transcript: ENSMUST00000206308
AA Change: C554R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000206722
AA Change: C171R
Predicted Effect probably benign
Transcript: ENSMUST00000206769
Predicted Effect probably benign
Transcript: ENSMUST00000215685
Predicted Effect probably benign
Transcript: ENSMUST00000216511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216960
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains a region with similarity to the cysteine-rich domain (CRD) of frizzled, a gene originally found in Drosophila that controls tissue polarity. This protein functions in eye development, where it is necessary for the maintenance of photoreceptor outer segments. Mutations in this gene cause retinal degeneration 6 in mice, which gives rise to a mouse model for human retinitis punctata albescens. Bicistronic transcripts composed of the coding sequences for this gene (Mfrp) and the C1q and tumor necrosis factor related protein 5 gene (C1qtnf5) have been identified, and the resulting products can interact with each other. Co-transcription of C1qtnf5 and Mfrp has been observed in both human and mouse. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mutations produce mice having small, white retinal spots and progressive photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,067,267 L739Q probably damaging Het
4933436I01Rik A T X: 67,920,049 Y401* probably null Het
Abcg3 A G 5: 104,963,638 V321A probably benign Het
Acad10 C A 5: 121,626,185 V894L possibly damaging Het
Adam9 A G 8: 24,992,224 I255T probably damaging Het
AF529169 T G 9: 89,601,203 T714P probably damaging Het
Ago3 T C 4: 126,346,751 Y785C probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Akap4 A G X: 7,077,356 S633G probably benign Het
Alox15 T A 11: 70,349,973 T194S probably benign Het
Amh T C 10: 80,806,416 S207P probably benign Het
Apc T A 18: 34,300,004 C415S possibly damaging Het
Atg14 G A 14: 47,545,841 R346C probably damaging Het
Atp5j2 A T 5: 145,184,579 L64Q probably damaging Het
Barhl2 C G 5: 106,457,313 E177Q probably benign Het
C1qtnf5 T C 9: 44,108,775 V232A probably damaging Het
Calr T C 8: 84,844,157 I290V probably benign Het
Cdh19 G C 1: 110,890,159 Q618E possibly damaging Het
Celsr2 G T 3: 108,414,214 D427E probably damaging Het
Cep250 T C 2: 155,989,504 S1294P probably damaging Het
Chrna7 T A 7: 63,099,286 T483S probably damaging Het
Clmn A T 12: 104,791,862 W132R probably damaging Het
Cpsf2 G A 12: 101,990,047 D370N probably benign Het
Crnn T C 3: 93,149,287 V460A probably benign Het
Daam1 T A 12: 71,988,929 I957N probably damaging Het
Defb9 T C 8: 21,881,889 K36R probably benign Het
Dock10 T A 1: 80,510,426 I2007F possibly damaging Het
Dpm1 A T 2: 168,217,747 V143D probably damaging Het
Dync1h1 T C 12: 110,625,732 V1110A possibly damaging Het
Erlec1 T G 11: 30,939,604 K373N possibly damaging Het
Fam160b1 T C 19: 57,385,377 F690L probably damaging Het
Fbxo40 C T 16: 36,969,941 G269E probably benign Het
Fbxw7 T A 3: 84,954,935 C70S possibly damaging Het
Fnbp1 G T 2: 31,053,047 R280S probably null Het
Gapvd1 G A 2: 34,700,841 R940C probably damaging Het
Gfod2 T C 8: 105,717,510 K134E possibly damaging Het
Gm13757 A T 2: 88,446,509 I143N probably damaging Het
Gpi1 A T 7: 34,220,803 probably null Het
Grik2 A T 10: 49,132,827 N721K possibly damaging Het
Gsn G T 2: 35,301,471 G455V probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpse A G 5: 100,692,238 S338P probably damaging Het
Hyal2 T C 9: 107,572,172 C376R probably damaging Het
Inf2 A G 12: 112,608,337 T781A unknown Het
Iscu A G 5: 113,777,018 probably benign Het
Kcna4 G A 2: 107,296,220 G433D possibly damaging Het
Kir3dl2 T A X: 136,456,275 N146I probably benign Het
Klrg1 T A 6: 122,282,762 Q17L possibly damaging Het
Krt82 T G 15: 101,545,162 Q263P probably benign Het
Mst1r T C 9: 107,914,763 Y833H probably damaging Het
Mst1r T A 9: 107,915,933 probably null Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nipal4 T C 11: 46,151,383 N157S probably damaging Het
Notch2 G A 3: 98,072,755 G195D probably damaging Het
Nrcam A T 12: 44,563,993 H492L probably benign Het
Olfr433 A T 1: 174,042,588 I213F probably damaging Het
Papln G A 12: 83,782,037 R817H probably damaging Het
Pcnx2 T C 8: 125,887,371 E447G probably benign Het
Pdp2 T C 8: 104,593,906 V129A probably benign Het
Plch2 A G 4: 154,984,953 F1072S possibly damaging Het
Prag1 T A 8: 36,102,927 D221E probably damaging Het
Prkg1 T C 19: 31,585,695 D102G probably damaging Het
Psme4 T A 11: 30,819,011 D662E probably benign Het
Ptprn T C 1: 75,254,820 probably null Het
Ptprz1 A G 6: 22,986,311 D370G probably damaging Het
Qser1 A G 2: 104,760,541 S1637P probably damaging Het
Sema6a T A 18: 47,270,629 H642L probably benign Het
Slc30a5 A T 13: 100,813,953 F209I probably benign Het
Slc4a3 G T 1: 75,552,191 E508* probably null Het
Stpg2 C T 3: 139,309,183 R370* probably null Het
Tas2r113 T A 6: 132,893,833 F275I probably benign Het
Tmem132d T G 5: 128,269,199 K86N probably damaging Het
Tpgs2 A T 18: 25,140,536 F189L probably damaging Het
Trmt6 A G 2: 132,811,048 S104P probably damaging Het
Trpv3 T C 11: 73,283,688 S294P probably damaging Het
Ugt2b36 A G 5: 87,080,868 probably null Het
Vmn1r170 A T 7: 23,606,481 M103L probably benign Het
Vmn2r107 T A 17: 20,355,617 probably null Het
Vmn2r5 C T 3: 64,504,221 E309K probably damaging Het
Vmn2r77 T C 7: 86,800,756 V70A probably benign Het
Other mutations in Mfrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Mfrp APN 9 44104689 missense probably benign 0.39
IGL02077:Mfrp APN 9 44105220 missense probably damaging 1.00
IGL02313:Mfrp APN 9 44102874 missense probably damaging 1.00
IGL02544:Mfrp APN 9 44102794 missense probably damaging 1.00
IGL02709:Mfrp APN 9 44103264 missense probably benign 0.00
R1592:Mfrp UTSW 9 44103222 missense probably damaging 1.00
R1728:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1729:Mfrp UTSW 9 44104587 missense possibly damaging 0.73
R1886:Mfrp UTSW 9 44103488 missense possibly damaging 0.94
R2146:Mfrp UTSW 9 44103718 missense probably benign 0.12
R2150:Mfrp UTSW 9 44103718 missense probably benign 0.12
R2512:Mfrp UTSW 9 44102538 missense probably benign 0.01
R3788:Mfrp UTSW 9 44105457 nonsense probably null
R4204:Mfrp UTSW 9 44105228 missense possibly damaging 0.86
R4240:Mfrp UTSW 9 44102866 missense possibly damaging 0.91
R4839:Mfrp UTSW 9 44102135 missense possibly damaging 0.89
R4963:Mfrp UTSW 9 44103264 missense probably benign 0.33
R5041:Mfrp UTSW 9 44102278 missense probably damaging 1.00
R6370:Mfrp UTSW 9 44106261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGAGACTGGACACCTGATG -3'
(R):5'- CGCAGAATCCCTTATCCAGG -3'

Sequencing Primer
(F):5'- GGACACCTGATGTTCATCTTTC -3'
(R):5'- ATCCAGGCCACCCTTGC -3'
Posted On2014-08-25