Incidental Mutation 'R2049:Pkhd1l1'
ID226266
Institutional Source Beutler Lab
Gene Symbol Pkhd1l1
Ensembl Gene ENSMUSG00000038725
Gene Namepolycystic kidney and hepatic disease 1-like 1
SynonymsPKHDL1, D86 mRNA, fibrocystin L
MMRRC Submission 040056-MU
Accession Numbers

Genbank: NM_138674; MGI: 2183153

Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R2049 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location44457494-44601369 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 44547513 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]
Predicted Effect probably benign
Transcript: ENSMUST00000038336
SMART Domains Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 1.6e-16 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1322 1.1e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 5.1e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 2.1e-10 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166957
SMART Domains Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 9.4e-18 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1323 3e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 3.7e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 9.7e-12 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209244
Meta Mutation Damage Score 0.1348 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (118/122)
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,584,987 R8* probably null Het
Abhd17a A G 10: 80,585,606 probably null Het
Acsm1 A G 7: 119,656,039 R415G probably damaging Het
Acta1 G T 8: 123,892,064 T360N probably benign Het
Adam6a T A 12: 113,544,429 S141T probably benign Het
Adgrd1 G T 5: 129,115,095 K76N probably benign Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agps T A 2: 75,858,926 M156K probably benign Het
Agxt A G 1: 93,137,315 I149V probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Arhgap18 T A 10: 26,849,942 D54E probably benign Het
Asb8 C A 15: 98,136,069 E202* probably null Het
Bmp5 A G 9: 75,893,790 I401V probably damaging Het
Bscl2 T C 19: 8,845,320 probably null Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep112 A G 11: 108,606,325 E697G probably damaging Het
Cerk G A 15: 86,142,808 S167L probably benign Het
Chrm3 T A 13: 9,878,335 I222F probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Commd10 A T 18: 46,963,747 T74S probably benign Het
Cyp4f39 T C 17: 32,482,138 F201L probably benign Het
Dennd4a A G 9: 64,889,605 T860A possibly damaging Het
Dlg5 A T 14: 24,154,647 I1253N probably damaging Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dnah9 A G 11: 66,044,683 M1970T probably damaging Het
Doxl2 T A 6: 48,977,755 L609* probably null Het
Dsc3 A T 18: 19,989,680 D62E possibly damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dusp7 C T 9: 106,373,897 T407M probably damaging Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Entpd5 A G 12: 84,396,858 I12T probably benign Het
Espn T C 4: 152,121,257 E408G probably damaging Het
Fam160a2 A T 7: 105,389,839 D64E probably damaging Het
Gdpd3 A G 7: 126,768,594 T200A probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5134 G A 10: 76,004,884 A521T possibly damaging Het
Gm8300 A G 12: 87,517,276 D127G unknown Het
Gm960 A G 19: 4,698,605 probably benign Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
H2-M10.1 T C 17: 36,325,216 D153G possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
I0C0044D17Rik A G 4: 98,820,296 probably benign Het
Igfn1 T A 1: 135,970,638 Q730L probably benign Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jmjd1c T A 10: 67,157,998 L86* probably null Het
Kat5 T A 19: 5,605,685 probably null Het
Kif14 A G 1: 136,487,080 N768S probably benign Het
Kif14 A G 1: 136,510,167 E1199G possibly damaging Het
Klhl29 A G 12: 5,137,876 S163P probably damaging Het
Kmt2c C A 5: 25,285,079 Q4287H probably damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myom2 T G 8: 15,106,379 I742S probably damaging Het
Narf A T 11: 121,250,369 R310* probably null Het
Nktr T A 9: 121,741,694 D167E probably damaging Het
Nle1 A G 11: 82,905,366 W183R probably damaging Het
Npas3 A G 12: 54,062,088 N425S probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1197 A T 2: 88,728,745 Y285N probably damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr816 A G 10: 129,912,167 V37A probably benign Het
Olfr965 A T 9: 39,720,115 D296V probably damaging Het
Olfr984 T A 9: 40,101,119 I124L probably benign Het
Optc A T 1: 133,903,796 probably null Het
Otol1 T A 3: 70,018,836 F115I probably benign Het
Parp8 T A 13: 116,894,886 D430V probably benign Het
Pex7 T A 10: 19,894,315 H123L probably damaging Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Plekha4 A G 7: 45,553,798 D704G probably benign Het
Plxnb2 T A 15: 89,159,002 N1453I probably damaging Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
Ppp1r1a G A 15: 103,531,406 T153I probably damaging Het
Pramef8 T A 4: 143,416,871 L69Q probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptpre A G 7: 135,670,695 probably benign Het
Ptprt A T 2: 161,534,545 I1312N probably damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rims1 C T 1: 22,596,435 C155Y probably damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Sltm G A 9: 70,581,301 G578S probably benign Het
Smyd5 A G 6: 85,444,318 E338G probably benign Het
Snx2 G A 18: 53,194,444 V81M probably damaging Het
Sp2 G T 11: 96,961,365 N244K probably benign Het
Sspo C A 6: 48,460,763 probably benign Het
Sspo A C 6: 48,463,531 D1568A probably benign Het
Ssrp1 T C 2: 85,041,427 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Syt7 G A 19: 10,439,213 R138Q probably benign Het
Taar7f T C 10: 24,050,425 Y306H possibly damaging Het
Tbccd1 T C 16: 22,818,541 probably null Het
Tex261 A G 6: 83,772,259 Y119H probably damaging Het
Tmem131l T G 3: 83,942,788 E234D probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubap1 C T 4: 41,379,257 A157V probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Uso1 G A 5: 92,181,936 G427R probably damaging Het
Usp15 A T 10: 123,119,137 V912D probably damaging Het
Vmn1r20 T C 6: 57,431,958 S90P probably damaging Het
Vmn1r32 T C 6: 66,553,561 K77R probably damaging Het
Vmn2r100 A G 17: 19,522,050 K229E probably benign Het
Vmn2r106 A G 17: 20,268,304 V611A possibly damaging Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Zbtb21 G T 16: 97,950,155 P804H probably damaging Het
Zdhhc3 T C 9: 123,100,537 D11G probably damaging Het
Zfhx3 A G 8: 108,945,177 T1324A probably benign Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfp608 G T 18: 54,895,565 L1259I probably damaging Het
Other mutations in Pkhd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pkhd1l1 APN 15 44477586 missense probably damaging 1.00
IGL00235:Pkhd1l1 APN 15 44556019 missense probably damaging 1.00
IGL00264:Pkhd1l1 APN 15 44491029 missense possibly damaging 0.67
IGL00537:Pkhd1l1 APN 15 44591992 missense possibly damaging 0.88
IGL00537:Pkhd1l1 APN 15 44500047 missense probably benign 0.42
IGL00580:Pkhd1l1 APN 15 44586474 missense probably damaging 0.98
IGL01085:Pkhd1l1 APN 15 44562752 splice site probably null
IGL01089:Pkhd1l1 APN 15 44483869 splice site probably benign
IGL01094:Pkhd1l1 APN 15 44546929 missense probably benign 0.09
IGL01120:Pkhd1l1 APN 15 44505312 critical splice donor site probably null
IGL01307:Pkhd1l1 APN 15 44530029 missense possibly damaging 0.82
IGL01362:Pkhd1l1 APN 15 44532982 missense probably benign 0.00
IGL01403:Pkhd1l1 APN 15 44483833 nonsense probably null
IGL01546:Pkhd1l1 APN 15 44566316 missense probably damaging 1.00
IGL01596:Pkhd1l1 APN 15 44529410 missense possibly damaging 0.50
IGL01696:Pkhd1l1 APN 15 44529351 missense possibly damaging 0.79
IGL01844:Pkhd1l1 APN 15 44499400 splice site probably benign
IGL02007:Pkhd1l1 APN 15 44533733 splice site probably benign
IGL02041:Pkhd1l1 APN 15 44493056 splice site probably null
IGL02171:Pkhd1l1 APN 15 44516146 missense possibly damaging 0.80
IGL02206:Pkhd1l1 APN 15 44512849 missense probably benign 0.08
IGL02266:Pkhd1l1 APN 15 44573614 missense probably damaging 1.00
IGL02487:Pkhd1l1 APN 15 44459426 missense possibly damaging 0.65
IGL02488:Pkhd1l1 APN 15 44558597 missense probably benign
IGL02522:Pkhd1l1 APN 15 44555902 missense possibly damaging 0.71
IGL02554:Pkhd1l1 APN 15 44578500 missense probably damaging 1.00
IGL02566:Pkhd1l1 APN 15 44526054 splice site probably null
IGL02602:Pkhd1l1 APN 15 44557931 missense probably damaging 1.00
IGL02606:Pkhd1l1 APN 15 44589456 missense probably benign 0.00
IGL02623:Pkhd1l1 APN 15 44584873 missense probably damaging 1.00
IGL02634:Pkhd1l1 APN 15 44539667 missense probably damaging 1.00
IGL02637:Pkhd1l1 APN 15 44564324 missense probably damaging 1.00
IGL02651:Pkhd1l1 APN 15 44483814 missense probably damaging 1.00
IGL02679:Pkhd1l1 APN 15 44530045 critical splice donor site probably null
IGL02684:Pkhd1l1 APN 15 44516209 critical splice donor site probably null
IGL02739:Pkhd1l1 APN 15 44540950 missense probably benign 0.11
IGL02831:Pkhd1l1 APN 15 44501493 missense probably benign 0.18
IGL02839:Pkhd1l1 APN 15 44529543 missense probably damaging 0.98
IGL02944:Pkhd1l1 APN 15 44501531 missense probably damaging 1.00
IGL02957:Pkhd1l1 APN 15 44512908 missense probably damaging 1.00
IGL03001:Pkhd1l1 APN 15 44558004 missense probably damaging 1.00
IGL03030:Pkhd1l1 APN 15 44591976 missense probably benign 0.00
IGL03030:Pkhd1l1 APN 15 44596902 missense probably benign 0.41
IGL03132:Pkhd1l1 APN 15 44574617 missense probably damaging 1.00
IGL03194:Pkhd1l1 APN 15 44518135 missense probably damaging 1.00
IGL03219:Pkhd1l1 APN 15 44596895 missense possibly damaging 0.62
IGL03236:Pkhd1l1 APN 15 44581826 missense probably damaging 1.00
IGL03266:Pkhd1l1 APN 15 44538952 missense probably damaging 1.00
IGL03276:Pkhd1l1 APN 15 44594584 missense possibly damaging 0.77
IGL03284:Pkhd1l1 APN 15 44547518 splice site probably benign
IGL03377:Pkhd1l1 APN 15 44484351 splice site probably null
K7371:Pkhd1l1 UTSW 15 44537442 missense possibly damaging 0.67
K7371:Pkhd1l1 UTSW 15 44500067 missense possibly damaging 0.94
N/A - 287:Pkhd1l1 UTSW 15 44582258 missense probably damaging 0.98
P4717OSA:Pkhd1l1 UTSW 15 44523499 missense probably benign 0.17
P4717OSA:Pkhd1l1 UTSW 15 44528247 missense probably damaging 1.00
R0007:Pkhd1l1 UTSW 15 44574398 splice site probably benign
R0020:Pkhd1l1 UTSW 15 44556872 missense probably damaging 1.00
R0034:Pkhd1l1 UTSW 15 44504009 missense probably benign 0.00
R0040:Pkhd1l1 UTSW 15 44573625 missense probably damaging 1.00
R0050:Pkhd1l1 UTSW 15 44573807 missense possibly damaging 0.79
R0050:Pkhd1l1 UTSW 15 44573807 missense possibly damaging 0.79
R0063:Pkhd1l1 UTSW 15 44529237 missense probably damaging 1.00
R0063:Pkhd1l1 UTSW 15 44529237 missense probably damaging 1.00
R0086:Pkhd1l1 UTSW 15 44556008 missense possibly damaging 0.94
R0103:Pkhd1l1 UTSW 15 44597141 missense probably benign
R0103:Pkhd1l1 UTSW 15 44597141 missense probably benign
R0127:Pkhd1l1 UTSW 15 44554605 missense probably damaging 0.99
R0226:Pkhd1l1 UTSW 15 44526784 missense possibly damaging 0.65
R0268:Pkhd1l1 UTSW 15 44597011 missense probably benign 0.15
R0294:Pkhd1l1 UTSW 15 44560435 missense probably benign 0.05
R0310:Pkhd1l1 UTSW 15 44522738 splice site probably benign
R0344:Pkhd1l1 UTSW 15 44597011 missense probably benign 0.15
R0449:Pkhd1l1 UTSW 15 44501519 missense probably damaging 1.00
R0492:Pkhd1l1 UTSW 15 44519690 missense probably benign 0.03
R0505:Pkhd1l1 UTSW 15 44589418 missense probably damaging 1.00
R0529:Pkhd1l1 UTSW 15 44526754 missense possibly damaging 0.62
R0543:Pkhd1l1 UTSW 15 44523491 critical splice acceptor site probably null
R0552:Pkhd1l1 UTSW 15 44489546 missense probably damaging 0.98
R0558:Pkhd1l1 UTSW 15 44484424 missense probably damaging 0.97
R0609:Pkhd1l1 UTSW 15 44467424 missense possibly damaging 0.48
R0619:Pkhd1l1 UTSW 15 44483838 missense probably damaging 1.00
R0727:Pkhd1l1 UTSW 15 44535788 missense possibly damaging 0.80
R0787:Pkhd1l1 UTSW 15 44529264 missense probably damaging 1.00
R0846:Pkhd1l1 UTSW 15 44495597 missense probably damaging 1.00
R0909:Pkhd1l1 UTSW 15 44538883 splice site probably null
R0942:Pkhd1l1 UTSW 15 44532959 missense probably benign 0.01
R1056:Pkhd1l1 UTSW 15 44591964 missense probably damaging 1.00
R1147:Pkhd1l1 UTSW 15 44537441 missense probably null 0.15
R1147:Pkhd1l1 UTSW 15 44537441 missense probably null 0.15
R1187:Pkhd1l1 UTSW 15 44498051 missense possibly damaging 0.65
R1328:Pkhd1l1 UTSW 15 44497996 missense probably benign 0.01
R1331:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1331:Pkhd1l1 UTSW 15 44589597 missense probably damaging 1.00
R1332:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1335:Pkhd1l1 UTSW 15 44505547 missense probably damaging 1.00
R1338:Pkhd1l1 UTSW 15 44526724 missense probably damaging 1.00
R1440:Pkhd1l1 UTSW 15 44540988 splice site probably benign
R1445:Pkhd1l1 UTSW 15 44505644 missense probably benign 0.32
R1458:Pkhd1l1 UTSW 15 44516115 missense probably benign 0.01
R1469:Pkhd1l1 UTSW 15 44536886 missense probably benign 0.45
R1469:Pkhd1l1 UTSW 15 44536886 missense probably benign 0.45
R1500:Pkhd1l1 UTSW 15 44545494 missense probably damaging 1.00
R1528:Pkhd1l1 UTSW 15 44526724 missense probably damaging 1.00
R1542:Pkhd1l1 UTSW 15 44528191 missense probably benign 0.44
R1568:Pkhd1l1 UTSW 15 44545501 splice site probably null
R1571:Pkhd1l1 UTSW 15 44526841 missense probably benign
R1572:Pkhd1l1 UTSW 15 44543473 missense probably benign 0.01
R1604:Pkhd1l1 UTSW 15 44467367 nonsense probably null
R1638:Pkhd1l1 UTSW 15 44597117 missense probably benign 0.06
R1639:Pkhd1l1 UTSW 15 44540955 missense probably damaging 0.99
R1737:Pkhd1l1 UTSW 15 44547509 critical splice donor site probably null
R1816:Pkhd1l1 UTSW 15 44528239 missense possibly damaging 0.91
R1826:Pkhd1l1 UTSW 15 44503345 missense possibly damaging 0.75
R1880:Pkhd1l1 UTSW 15 44525242 missense probably benign 0.13
R1930:Pkhd1l1 UTSW 15 44503337 missense possibly damaging 0.69
R1933:Pkhd1l1 UTSW 15 44540884 missense possibly damaging 0.48
R1938:Pkhd1l1 UTSW 15 44500038 missense probably benign
R1975:Pkhd1l1 UTSW 15 44529713 missense probably damaging 1.00
R1999:Pkhd1l1 UTSW 15 44499982 intron probably null
R2037:Pkhd1l1 UTSW 15 44568221 splice site probably null
R2045:Pkhd1l1 UTSW 15 44479654 missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44581741 missense probably damaging 1.00
R2063:Pkhd1l1 UTSW 15 44550752 missense possibly damaging 0.69
R2072:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2073:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2075:Pkhd1l1 UTSW 15 44558639 missense probably damaging 1.00
R2078:Pkhd1l1 UTSW 15 44527767 missense probably benign 0.08
R2116:Pkhd1l1 UTSW 15 44569482 missense probably damaging 0.97
R2133:Pkhd1l1 UTSW 15 44516185 missense possibly damaging 0.91
R2138:Pkhd1l1 UTSW 15 44501457 missense probably damaging 1.00
R2139:Pkhd1l1 UTSW 15 44529818 missense possibly damaging 0.46
R2145:Pkhd1l1 UTSW 15 44512877 synonymous probably null
R2150:Pkhd1l1 UTSW 15 44499982 intron probably null
R2177:Pkhd1l1 UTSW 15 44459395 missense probably benign
R2184:Pkhd1l1 UTSW 15 44499296 missense possibly damaging 0.89
R2216:Pkhd1l1 UTSW 15 44573895 missense probably damaging 1.00
R2226:Pkhd1l1 UTSW 15 44512792 missense possibly damaging 0.79
R2227:Pkhd1l1 UTSW 15 44512792 missense possibly damaging 0.79
R2243:Pkhd1l1 UTSW 15 44546927 missense probably damaging 1.00
R2290:Pkhd1l1 UTSW 15 44528250 missense probably benign 0.03
R2294:Pkhd1l1 UTSW 15 44479607 missense probably damaging 0.99
R2346:Pkhd1l1 UTSW 15 44560506 missense possibly damaging 0.82
R2356:Pkhd1l1 UTSW 15 44533019 missense probably benign 0.00
R2386:Pkhd1l1 UTSW 15 44528178 missense probably benign 0.00
R2404:Pkhd1l1 UTSW 15 44550820 missense probably damaging 1.00
R2504:Pkhd1l1 UTSW 15 44485428 missense probably damaging 0.97
R2679:Pkhd1l1 UTSW 15 44545386 missense probably damaging 0.99
R2860:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2861:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2862:Pkhd1l1 UTSW 15 44540871 missense probably damaging 1.00
R2972:Pkhd1l1 UTSW 15 44547248 missense possibly damaging 0.65
R3016:Pkhd1l1 UTSW 15 44545370 missense probably benign 0.02
R3162:Pkhd1l1 UTSW 15 44505528 missense probably damaging 1.00
R3162:Pkhd1l1 UTSW 15 44505528 missense probably damaging 1.00
R3416:Pkhd1l1 UTSW 15 44547364 missense probably damaging 1.00
R3623:Pkhd1l1 UTSW 15 44526869 missense probably damaging 1.00
R3687:Pkhd1l1 UTSW 15 44546587 missense probably benign 0.17
R3755:Pkhd1l1 UTSW 15 44589406 missense probably damaging 1.00
R3776:Pkhd1l1 UTSW 15 44514975 critical splice donor site probably null
R3803:Pkhd1l1 UTSW 15 44493135 missense probably benign 0.25
R3942:Pkhd1l1 UTSW 15 44592026 critical splice donor site probably null
R4010:Pkhd1l1 UTSW 15 44529100 missense possibly damaging 0.80
R4049:Pkhd1l1 UTSW 15 44498557 missense probably damaging 1.00
R4059:Pkhd1l1 UTSW 15 44550760 missense probably benign 0.01
R4179:Pkhd1l1 UTSW 15 44523649 missense probably benign 0.45
R4184:Pkhd1l1 UTSW 15 44591906 missense probably benign 0.00
R4369:Pkhd1l1 UTSW 15 44505553 missense probably benign 0.00
R4462:Pkhd1l1 UTSW 15 44581804 missense probably damaging 1.00
R4551:Pkhd1l1 UTSW 15 44550885 missense probably damaging 1.00
R4618:Pkhd1l1 UTSW 15 44539682 missense probably damaging 1.00
R4632:Pkhd1l1 UTSW 15 44484400 missense probably benign 0.07
R4657:Pkhd1l1 UTSW 15 44547347 missense probably damaging 1.00
R4716:Pkhd1l1 UTSW 15 44556032 missense probably damaging 1.00
R4788:Pkhd1l1 UTSW 15 44498021 missense probably damaging 0.99
R4828:Pkhd1l1 UTSW 15 44529405 missense possibly damaging 0.55
R4858:Pkhd1l1 UTSW 15 44491101 missense probably damaging 0.99
R4860:Pkhd1l1 UTSW 15 44537378 missense possibly damaging 0.77
R4860:Pkhd1l1 UTSW 15 44537378 missense possibly damaging 0.77
R4951:Pkhd1l1 UTSW 15 44533891 missense possibly damaging 0.82
R4963:Pkhd1l1 UTSW 15 44504025 missense probably benign 0.00
R5023:Pkhd1l1 UTSW 15 44528191 missense probably benign 0.44
R5023:Pkhd1l1 UTSW 15 44582227 missense probably benign 0.00
R5035:Pkhd1l1 UTSW 15 44568324 missense probably damaging 1.00
R5049:Pkhd1l1 UTSW 15 44457616 missense probably benign 0.00
R5065:Pkhd1l1 UTSW 15 44582293 missense possibly damaging 0.68
R5089:Pkhd1l1 UTSW 15 44591887 missense probably benign 0.01
R5151:Pkhd1l1 UTSW 15 44505309 missense probably benign 0.00
R5153:Pkhd1l1 UTSW 15 44505309 missense probably benign 0.00
R5189:Pkhd1l1 UTSW 15 44547148 missense probably damaging 1.00
R5204:Pkhd1l1 UTSW 15 44547041 missense possibly damaging 0.51
R5216:Pkhd1l1 UTSW 15 44495647 nonsense probably null
R5286:Pkhd1l1 UTSW 15 44514972 nonsense probably null
R5292:Pkhd1l1 UTSW 15 44529566 missense probably damaging 1.00
R5293:Pkhd1l1 UTSW 15 44535750 missense probably benign 0.01
R5298:Pkhd1l1 UTSW 15 44504046 missense probably benign 0.00
R5327:Pkhd1l1 UTSW 15 44546862 missense probably damaging 1.00
R5346:Pkhd1l1 UTSW 15 44540967 missense probably damaging 1.00
R5481:Pkhd1l1 UTSW 15 44558646 missense probably damaging 1.00
R5645:Pkhd1l1 UTSW 15 44532992 missense probably benign 0.18
R5718:Pkhd1l1 UTSW 15 44545417 missense probably damaging 1.00
R5809:Pkhd1l1 UTSW 15 44519707 missense probably benign 0.03
R5816:Pkhd1l1 UTSW 15 44566322 missense probably benign 0.01
R5854:Pkhd1l1 UTSW 15 44581790 missense probably damaging 1.00
R5876:Pkhd1l1 UTSW 15 44578588 missense possibly damaging 0.51
R5909:Pkhd1l1 UTSW 15 44526763 missense probably damaging 1.00
R5950:Pkhd1l1 UTSW 15 44532965 missense probably benign 0.00
R5961:Pkhd1l1 UTSW 15 44459463 missense probably damaging 1.00
R5972:Pkhd1l1 UTSW 15 44545416 missense probably damaging 1.00
R5975:Pkhd1l1 UTSW 15 44525988 missense probably damaging 1.00
R5982:Pkhd1l1 UTSW 15 44489504 splice site probably null
R6066:Pkhd1l1 UTSW 15 44528129 missense probably damaging 0.99
R6122:Pkhd1l1 UTSW 15 44557940 missense probably damaging 1.00
R6248:Pkhd1l1 UTSW 15 44529559 missense probably benign
R6294:Pkhd1l1 UTSW 15 44570028 missense probably damaging 1.00
R6301:Pkhd1l1 UTSW 15 44589525 missense probably damaging 0.99
R6526:Pkhd1l1 UTSW 15 44498089 critical splice donor site probably null
R6707:Pkhd1l1 UTSW 15 44529143 missense probably benign
R6736:Pkhd1l1 UTSW 15 44557940 missense probably damaging 1.00
R6753:Pkhd1l1 UTSW 15 44589663 missense probably benign 0.45
R6815:Pkhd1l1 UTSW 15 44562655 missense probably damaging 1.00
R6874:Pkhd1l1 UTSW 15 44589527 missense probably benign 0.06
R6942:Pkhd1l1 UTSW 15 44522629 missense probably damaging 1.00
R6970:Pkhd1l1 UTSW 15 44511674 missense possibly damaging 0.61
R6982:Pkhd1l1 UTSW 15 44566268 missense probably damaging 0.97
R7103:Pkhd1l1 UTSW 15 44573631 missense not run
R7116:Pkhd1l1 UTSW 15 44557976 missense not run
R7135:Pkhd1l1 UTSW 15 44584978 critical splice donor site unknown
R7143:Pkhd1l1 UTSW 15 44573637 missense not run
X0027:Pkhd1l1 UTSW 15 44591966 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGTGTGGCTTTAGGAGTAAC -3'
(R):5'- GTGATACTGGTGAATCAGCCTTAAC -3'

Sequencing Primer
(F):5'- CATCAATCACTGGGGTGTGTAATGAC -3'
(R):5'- GGTGAATCAGCCTTAACCATTC -3'
Posted On2014-09-17