Incidental Mutation 'R2179:Olfr979'
ID237058
Institutional Source Beutler Lab
Gene Symbol Olfr979
Ensembl Gene ENSMUSG00000059473
Gene Nameolfactory receptor 979
SynonymsMOR223-1, GA_x6K02T2PVTD-33699706-33698771
MMRRC Submission 040181-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2179 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39998003-40003465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40000924 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 101 (Y101C)
Ref Sequence ENSEMBL: ENSMUSP00000148903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080835] [ENSMUST00000215523] [ENSMUST00000216463]
Predicted Effect probably benign
Transcript: ENSMUST00000080835
AA Change: Y101C

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079648
Gene: ENSMUSG00000059473
AA Change: Y101C

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 7.9e-58 PFAM
Pfam:7tm_1 39 287 5.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215523
AA Change: Y101C

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000216463
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T C 10: 10,395,274 D849G possibly damaging Het
Amz2 A G 11: 109,429,832 H155R probably damaging Het
BC027072 T C 17: 71,752,526 D52G probably damaging Het
Chuk C A 19: 44,103,721 C46F possibly damaging Het
Cp A T 3: 19,987,987 D973V probably damaging Het
Cpm T A 10: 117,683,361 D391E probably benign Het
Creb3 T C 4: 43,566,306 S271P probably damaging Het
Cubn T A 2: 13,318,242 H2838L possibly damaging Het
Dennd2d A G 3: 106,492,460 H233R probably benign Het
Dnaaf2 C A 12: 69,198,297 probably benign Het
Enpp3 T A 10: 24,805,895 Q304H probably benign Het
Fermt3 C A 19: 7,014,414 R143L probably benign Het
Fndc8 A C 11: 82,898,754 K246T probably damaging Het
Gaa A G 11: 119,275,058 probably null Het
Gm4788 G T 1: 139,731,541 P679Q probably damaging Het
Gucy2e A T 11: 69,228,578 probably null Het
Igf1r A G 7: 68,003,950 T79A probably damaging Het
Ikbkb C T 8: 22,681,753 probably null Het
Il16 A T 7: 83,688,079 probably null Het
Irs1 T A 1: 82,290,219 H92L possibly damaging Het
Itpr2 A G 6: 146,375,966 M315T probably benign Het
Lrba T G 3: 86,354,281 L1514R probably damaging Het
Mcpt2 A G 14: 56,042,116 probably benign Het
Metap1d A G 2: 71,453,371 I5V probably benign Het
Mga T A 2: 119,960,442 S2479T probably damaging Het
Mllt10 T C 2: 18,210,793 V1063A probably damaging Het
Mroh2b G A 15: 4,921,446 probably null Het
Mtfr1 C T 3: 19,200,144 R15* probably null Het
Npm2 A G 14: 70,648,309 V152A probably benign Het
Nrxn3 T A 12: 89,254,678 V409D probably damaging Het
Ogdhl A G 14: 32,335,345 N303D probably damaging Het
Olfr1423 T C 19: 12,036,088 Y218C probably damaging Het
Olfr1491 T C 19: 13,705,394 V189A probably damaging Het
Olfr750 A G 14: 51,070,781 V204A probably benign Het
Pah T C 10: 87,567,335 F191L probably damaging Het
Paics A T 5: 76,961,444 I209F probably damaging Het
Pld6 A G 11: 59,787,358 L93P probably damaging Het
Plod3 T C 5: 136,991,008 F431L possibly damaging Het
Ppm1b T A 17: 84,994,434 D247E probably damaging Het
Prx A G 7: 27,517,985 D637G probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,909 probably benign Het
Ryr2 A T 13: 11,705,793 Y2656* probably null Het
Setd2 T A 9: 110,594,688 Y492* probably null Het
Shmt1 A G 11: 60,806,999 W9R possibly damaging Het
Slc25a17 A G 15: 81,337,950 V107A probably benign Het
Sptlc1 A T 13: 53,351,639 Y248N probably damaging Het
Stam2 T C 2: 52,694,924 T453A probably benign Het
Tango2 G T 16: 18,310,898 N77K probably damaging Het
Tas2r121 A T 6: 132,700,868 I47N probably damaging Het
Terb1 A T 8: 104,452,715 C614S probably damaging Het
Terb1 T C 8: 104,472,737 N525S probably benign Het
Ttc6 A G 12: 57,673,118 D825G possibly damaging Het
U90926 A T 5: 92,209,979 H104Q probably benign Het
Zfand4 G A 6: 116,314,781 A559T possibly damaging Het
Zfp462 T C 4: 55,009,524 S497P possibly damaging Het
Other mutations in Olfr979
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Olfr979 APN 9 40000886 missense probably damaging 1.00
IGL02939:Olfr979 APN 9 40000898 missense probably benign 0.26
IGL02991:Olfr979 UTSW 9 40000402 missense probably damaging 1.00
R1388:Olfr979 UTSW 9 40000652 missense probably damaging 0.99
R1572:Olfr979 UTSW 9 40001194 missense probably benign 0.35
R2089:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2091:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R2091:Olfr979 UTSW 9 40001204 missense probably benign 0.01
R3424:Olfr979 UTSW 9 40000534 missense probably damaging 0.97
R3964:Olfr979 UTSW 9 40000471 missense possibly damaging 0.95
R3965:Olfr979 UTSW 9 40000471 missense possibly damaging 0.95
R4111:Olfr979 UTSW 9 40000898 nonsense probably null
R4537:Olfr979 UTSW 9 40000320 missense probably benign 0.01
R4737:Olfr979 UTSW 9 40000422 missense probably damaging 0.96
R4926:Olfr979 UTSW 9 40001023 unclassified probably null
R5303:Olfr979 UTSW 9 40000588 missense probably damaging 1.00
R5587:Olfr979 UTSW 9 40000621 missense possibly damaging 0.90
R6387:Olfr979 UTSW 9 40000852 missense probably damaging 0.99
R6394:Olfr979 UTSW 9 40000705 missense probably benign 0.04
R6765:Olfr979 UTSW 9 40001197 missense probably damaging 1.00
R7312:Olfr979 UTSW 9 40000810 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TAGTCTGGACAGCAGAGTGC -3'
(R):5'- GGACACCATGCTCTTTGTAGC -3'

Sequencing Primer
(F):5'- TACCTGAGTGGGTAACTG -3'
(R):5'- ACTGTGCTGGGCAACTTC -3'
Posted On2014-10-02