Incidental Mutation 'R2227:Zfp735'
ID239801
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Namezinc finger protein 735
Synonyms1700012C15Rik
MMRRC Submission 040228-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2227 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73688778-73713798 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 73711397 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 389 (L389*)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
Predicted Effect probably null
Transcript: ENSMUST00000080407
AA Change: L389*
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: L389*

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149560
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik T A 14: 60,088,219 probably benign Het
Abtb1 A C 6: 88,836,367 L439R probably damaging Het
Adcy10 A G 1: 165,518,260 T293A probably damaging Het
Agl A T 3: 116,788,312 V306D possibly damaging Het
Alpk2 T A 18: 65,378,076 T17S probably damaging Het
Ar T A X: 98,151,331 M517K probably benign Het
Atg9b A G 5: 24,386,395 V735A possibly damaging Het
BB014433 C A 8: 15,041,717 A379S probably benign Het
BC005561 T A 5: 104,519,420 Y603N probably damaging Het
Ccdc33 A G 9: 58,082,022 S123P probably damaging Het
Ccl2 G T 11: 82,036,601 probably null Het
Cct2 T C 10: 117,053,017 R526G probably null Het
Cep55 T C 19: 38,062,634 M164T probably benign Het
Clec2d G A 6: 129,184,251 A104T probably benign Het
Cyp3a11 A G 5: 145,868,547 L220P possibly damaging Het
Dgkk T A X: 6,875,248 D102E probably damaging Het
Emcn T C 3: 137,404,017 I140T possibly damaging Het
Exoc2 T A 13: 30,864,884 I729L probably benign Het
Fbxl20 T C 11: 98,090,849 I338V probably benign Het
Gm4985 T A X: 23,958,934 M1L probably null Het
Gm6614 T G 6: 141,992,361 E277D possibly damaging Het
Gucy2c G A 6: 136,702,760 T943I probably damaging Het
Hdac9 C T 12: 34,407,802 V251I probably benign Het
Hoxa10 T C 6: 52,232,636 E52G probably damaging Het
Il17rb A T 14: 30,006,081 S56R probably benign Het
Knl1 A G 2: 119,072,000 D1394G probably damaging Het
Kpna1 G A 16: 36,031,221 A392T probably damaging Het
Krt6b A G 15: 101,679,122 V179A probably damaging Het
Lpar5 A T 6: 125,081,135 probably null Het
March7 A G 2: 60,229,846 R106G probably benign Het
Mtus1 C T 8: 41,082,775 V635M probably damaging Het
Myl1 T C 1: 66,944,815 K31E possibly damaging Het
Myt1l T A 12: 29,826,970 L207I unknown Het
Naalad2 A T 9: 18,376,533 V267E possibly damaging Het
Pkhd1l1 T C 15: 44,512,792 I950T possibly damaging Het
Ppp1r9a G T 6: 5,154,074 R1081L probably benign Het
Rc3h1 T C 1: 160,963,542 I932T probably benign Het
Rubcnl G A 14: 75,042,392 R405Q probably benign Het
Sgsm3 A G 15: 81,003,868 E53G probably damaging Het
Spin2g A T X: 34,237,275 I171N possibly damaging Het
Srsf6 G A 2: 162,931,699 S10N probably damaging Het
Tex45 A G 8: 3,479,249 T245A probably benign Het
Tnn A T 1: 160,147,465 C131S probably damaging Het
Tnnt2 A G 1: 135,843,791 probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn1r86 T C 7: 13,102,920 I10V probably benign Het
Xpot T C 10: 121,622,860 R20G probably damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73711366 missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73711560 missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73710479 missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73690365 missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73711428 missense probably benign 0.01
IGL02238:Zfp735 APN 11 73710493 missense probably benign 0.00
IGL02505:Zfp735 APN 11 73689800 missense probably benign 0.03
IGL02740:Zfp735 APN 11 73710586 missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73710929 missense probably benign 0.00
R0114:Zfp735 UTSW 11 73710662 missense probably benign 0.33
R0217:Zfp735 UTSW 11 73711286 missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73712083 missense probably benign 0.04
R1421:Zfp735 UTSW 11 73710697 missense probably benign
R1460:Zfp735 UTSW 11 73712333 missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73710479 missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73710644 missense probably benign
R1676:Zfp735 UTSW 11 73711475 missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73711763 missense probably benign 0.01
R1871:Zfp735 UTSW 11 73710586 nonsense probably null
R1931:Zfp735 UTSW 11 73711851 missense possibly damaging 0.69
R2219:Zfp735 UTSW 11 73711025 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711396 missense possibly damaging 0.53
R3552:Zfp735 UTSW 11 73711241 nonsense probably null
R3856:Zfp735 UTSW 11 73711456 missense probably benign 0.01
R3925:Zfp735 UTSW 11 73711124 missense probably benign 0.33
R4572:Zfp735 UTSW 11 73689785 missense probably benign 0.02
R4585:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73711205 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711855 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711856 missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73712113 missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73710593 nonsense probably null
R5516:Zfp735 UTSW 11 73710814 missense probably benign
R5654:Zfp735 UTSW 11 73712138 missense possibly damaging 0.71
R5990:Zfp735 UTSW 11 73690348 missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73711678 nonsense probably null
R6427:Zfp735 UTSW 11 73690314 missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73711652 missense probably benign 0.33
R6820:Zfp735 UTSW 11 73688957 start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73711054 missense probably benign 0.08
R6941:Zfp735 UTSW 11 73690333 missense probably benign 0.33
R7335:Zfp735 UTSW 11 73711553 missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73712153 missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73711176 missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73690328 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGCTAGGTCTAATCACTGCTCTC -3'
(R):5'- GCCTGAGGGTTTACTGGAAC -3'

Sequencing Primer
(F):5'- CTCAGTCAATTTTGCAACAGCAGG -3'
(R):5'- CCTGAGGGTTTACTGGAACATTTC -3'
Posted On2014-10-15