Incidental Mutation 'R2274:Tsr1'
ID244988
Institutional Source Beutler Lab
Gene Symbol Tsr1
Ensembl Gene ENSMUSG00000038335
Gene NameTSR1 20S rRNA accumulation
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R2274 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74898071-74909342 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 74904827 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045807] [ENSMUST00000065211] [ENSMUST00000108447] [ENSMUST00000108448] [ENSMUST00000121738] [ENSMUST00000128230] [ENSMUST00000128556] [ENSMUST00000153316] [ENSMUST00000155702] [ENSMUST00000155702]
Predicted Effect probably null
Transcript: ENSMUST00000045807
SMART Domains Protein: ENSMUSP00000039027
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
AARP2CN 228 309 1.14e-28 SMART
low complexity region 373 383 N/A INTRINSIC
low complexity region 407 421 N/A INTRINSIC
low complexity region 429 452 N/A INTRINSIC
coiled coil region 453 478 N/A INTRINSIC
DUF663 486 772 2.6e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065211
SMART Domains Protein: ENSMUSP00000067552
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104449
Predicted Effect probably benign
Transcript: ENSMUST00000108447
SMART Domains Protein: ENSMUSP00000104086
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 179 1.8e-41 PFAM
Pfam:PALP 173 289 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108448
SMART Domains Protein: ENSMUSP00000104087
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 2.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121738
SMART Domains Protein: ENSMUSP00000113372
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127499
Predicted Effect probably benign
Transcript: ENSMUST00000128230
SMART Domains Protein: ENSMUSP00000121384
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128556
SMART Domains Protein: ENSMUSP00000120012
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 182 2.6e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144019
Predicted Effect probably benign
Transcript: ENSMUST00000153316
Predicted Effect probably benign
Transcript: ENSMUST00000155702
SMART Domains Protein: ENSMUSP00000119868
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155702
SMART Domains Protein: ENSMUSP00000119868
Gene: ENSMUSG00000038335

DomainStartEndE-ValueType
low complexity region 16 25 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155785
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik A T 11: 99,837,841 C59S possibly damaging Het
Abca5 A T 11: 110,275,281 N1556K possibly damaging Het
Abcb10 G T 8: 123,982,752 A21E probably benign Het
Ackr1 T C 1: 173,332,485 N156D probably benign Het
Adamtsl3 A T 7: 82,606,558 S1593C probably benign Het
Ank3 T A 10: 69,950,942 probably null Het
Aqp4 A G 18: 15,393,480 S315P probably benign Het
Atp7b T C 8: 22,020,832 I433V probably benign Het
Bco1 G A 8: 117,108,783 probably null Het
Cacna1g T A 11: 94,415,936 E1842V probably damaging Het
Calhm3 T A 19: 47,157,547 Q73L probably damaging Het
Car5a C T 8: 121,944,669 probably null Het
Cdk11b T A 4: 155,647,594 probably benign Het
Cdr2 A T 7: 120,958,509 H264Q possibly damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Dnlz A T 2: 26,351,471 C82S probably damaging Het
Egr4 A T 6: 85,512,743 F112I probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
F11 T C 8: 45,252,147 D119G possibly damaging Het
Fat4 T A 3: 38,995,899 V3970D possibly damaging Het
Fbxw5 C A 2: 25,504,761 C222* probably null Het
Fn1 C T 1: 71,613,943 G1296R probably null Het
Ghr A G 15: 3,320,025 V557A probably benign Het
Gm11568 A G 11: 99,858,244 S92G unknown Het
Gpatch1 A T 7: 35,288,678 S678T probably benign Het
Gpr155 A G 2: 73,348,135 probably null Het
Gucy2f A T X: 142,116,273 M697K probably benign Het
Hecw1 T C 13: 14,346,068 T195A probably benign Het
Hoxd1 A G 2: 74,764,157 K252R probably damaging Het
Iqck G A 7: 118,899,657 D173N possibly damaging Het
Irf8 A G 8: 120,753,527 E168G probably damaging Het
Kcnh1 T G 1: 192,337,521 V358G probably damaging Het
Kifap3 T A 1: 163,868,758 V652D possibly damaging Het
L3hypdh T C 12: 72,084,858 Y100C possibly damaging Het
Map4k1 T A 7: 29,001,957 H729Q probably damaging Het
March1 T A 8: 66,387,499 N311K probably benign Het
Mier2 T C 10: 79,544,534 I321V probably damaging Het
Mta1 C T 12: 113,128,150 S291L probably damaging Het
Myh2 A G 11: 67,190,358 K1267E possibly damaging Het
Nbea A T 3: 55,988,085 probably null Het
Nexmif T G X: 104,087,846 E155A possibly damaging Het
Nkpd1 A G 7: 19,523,897 I534V probably benign Het
Nxph1 G T 6: 9,247,746 C239F probably damaging Het
Odc1 A G 12: 17,548,424 I189V probably benign Het
Olfr1170 A G 2: 88,224,823 F70L probably benign Het
Olfr314 T C 11: 58,786,666 V144A probably benign Het
Olfr351 A T 2: 36,860,101 N82K probably damaging Het
Olfr781 T C 10: 129,333,457 I192T probably benign Het
Pcdhb15 T C 18: 37,475,443 L576P probably damaging Het
Raph1 T C 1: 60,498,500 D499G probably damaging Het
Rptor T A 11: 119,756,322 C246* probably null Het
Rtl1 T C 12: 109,594,667 E246G unknown Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc12a3 T A 8: 94,333,287 I187N possibly damaging Het
Slc46a1 T G 11: 78,466,423 S101A probably benign Het
Slc4a8 A G 15: 100,807,402 M830V probably benign Het
Sned1 T A 1: 93,281,642 probably null Het
St3gal6 T A 16: 58,488,969 E34D possibly damaging Het
Tcstv3 C T 13: 120,317,654 Q30* probably null Het
Tex16 T A X: 112,121,141 D1112E probably damaging Het
Tmcc3 G A 10: 94,578,915 V160I probably damaging Het
Tmf1 T A 6: 97,163,586 L776F probably damaging Het
Tyrp1 A T 4: 80,837,534 E180V probably damaging Het
Ubr3 T C 2: 70,016,341 V1636A probably benign Het
Usp1 T C 4: 98,929,842 L139P probably damaging Het
Vmn1r232 A G 17: 20,914,203 L45P probably benign Het
Vmn1r49 G A 6: 90,072,144 T292I probably benign Het
Wdr19 T A 5: 65,240,991 M853K possibly damaging Het
Zkscan8 C T 13: 21,521,796 M265I probably benign Het
Other mutations in Tsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02568:Tsr1 APN 11 74900378 missense probably benign 0.19
IGL02959:Tsr1 APN 11 74900249 missense probably benign 0.00
IGL03230:Tsr1 APN 11 74900471 missense probably benign 0.00
IGL03358:Tsr1 APN 11 74903998 missense probably benign 0.13
R0684:Tsr1 UTSW 11 74907941 missense probably damaging 1.00
R1452:Tsr1 UTSW 11 74899599 missense probably benign 0.21
R1484:Tsr1 UTSW 11 74902088 missense probably damaging 1.00
R1831:Tsr1 UTSW 11 74900356 missense probably benign 0.00
R2166:Tsr1 UTSW 11 74907454 splice site probably null
R2185:Tsr1 UTSW 11 74902080 missense probably damaging 1.00
R2273:Tsr1 UTSW 11 74904827 critical splice acceptor site probably null
R2275:Tsr1 UTSW 11 74904827 critical splice acceptor site probably null
R2289:Tsr1 UTSW 11 74899285 missense probably damaging 0.98
R3606:Tsr1 UTSW 11 74905233 missense probably benign 0.01
R4928:Tsr1 UTSW 11 74907879 missense probably benign
R5260:Tsr1 UTSW 11 74905955 missense probably damaging 1.00
R6020:Tsr1 UTSW 11 74900293 unclassified probably null
R6743:Tsr1 UTSW 11 74908351 missense probably benign 0.00
R7068:Tsr1 UTSW 11 74903919 nonsense probably null
R7117:Tsr1 UTSW 11 74899534 missense probably benign
X0010:Tsr1 UTSW 11 74903874 missense possibly damaging 0.78
X0026:Tsr1 UTSW 11 74900227 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTTTAGGCTGATGTGGAACCATG -3'
(R):5'- AGGTACCTCAGCTCCTTCAG -3'

Sequencing Primer
(F):5'- ATGTGGAACCATGATCCTGC -3'
(R):5'- CCTTCAGCTTCTTTTTCCTCAATC -3'
Posted On2014-10-30