Incidental Mutation 'R2410:Rab14'
ID249940
Institutional Source Beutler Lab
Gene Symbol Rab14
Ensembl Gene ENSMUSG00000026878
Gene NameRAB14, member RAS oncogene family
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R2410 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location35180205-35201120 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 35186750 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028238] [ENSMUST00000113025] [ENSMUST00000230751]
Predicted Effect probably null
Transcript: ENSMUST00000028238
SMART Domains Protein: ENSMUSP00000028238
Gene: ENSMUSG00000026878

DomainStartEndE-ValueType
RAB 12 175 1.4e-109 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113025
SMART Domains Protein: ENSMUSP00000108648
Gene: ENSMUSG00000026878

DomainStartEndE-ValueType
RAB 12 151 5.28e-78 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202602
Predicted Effect probably null
Transcript: ENSMUST00000230657
Predicted Effect probably null
Transcript: ENSMUST00000230751
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAB14 belongs to the large RAB family of low molecular mass GTPases that are involved in intracellular membrane trafficking. These proteins act as molecular switches that flip between an inactive GDP-bound state and an active GTP-bound state in which they recruit downstream effector proteins onto membranes (Junutula et al., 2004 [PubMed 15004230]).[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Adgrf5 C A 17: 43,455,266 N1326K probably benign Het
Ciita A G 16: 10,510,704 E284G probably damaging Het
Ctbp2 T C 7: 133,014,354 Y284C probably benign Het
Dnah11 T C 12: 118,027,527 D2368G probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Erich3 A G 3: 154,733,603 D491G probably damaging Het
Ero1l C T 14: 45,305,266 V101I possibly damaging Het
Fbxl7 A G 15: 26,895,025 Y9H possibly damaging Het
Fzd2 A G 11: 102,605,627 Y299C possibly damaging Het
Lamc1 G A 1: 153,247,395 T683M possibly damaging Het
Lrrc39 C T 3: 116,581,250 P327S probably benign Het
Marf1 A T 16: 14,115,827 F1566I probably benign Het
Me2 A T 18: 73,791,112 M343K probably damaging Het
Mlxip T A 5: 123,443,069 W260R probably damaging Het
Mrps17 T C 5: 129,717,983 V64A probably damaging Het
Olfr1223 A T 2: 89,144,555 I156N possibly damaging Het
Phldb3 C T 7: 24,624,294 S450L probably benign Het
Pi4k2a A G 19: 42,104,877 E219G possibly damaging Het
Polr1a T C 6: 71,974,882 S1478P probably benign Het
Rnf43 T C 11: 87,732,259 Y729H possibly damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Sorbs1 T A 19: 40,373,515 I142F probably damaging Het
Tmem255b A G 8: 13,441,278 I66V probably benign Het
Vmn2r9 T C 5: 108,848,257 D175G probably damaging Het
Zfp954 A T 7: 7,117,809 I74N probably benign Het
Other mutations in Rab14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Rab14 APN 2 35183386 splice site probably benign
R1676:Rab14 UTSW 2 35186723 missense possibly damaging 0.47
R4832:Rab14 UTSW 2 35189966 missense probably damaging 1.00
R5537:Rab14 UTSW 2 35192637 missense possibly damaging 0.61
R7061:Rab14 UTSW 2 35183417 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGAATGGTCTCTTAATCTTAGCAC -3'
(R):5'- TGGAGTAGCCATCTCATCAAAG -3'

Sequencing Primer
(F):5'- TCTCTTAATCTTAGCACCCAAATAAC -3'
(R):5'- TGAGACTGTTGTACAAGCCATG -3'
Posted On2014-11-12