Incidental Mutation 'R2863:Or8b56'
ID 253037
Institutional Source Beutler Lab
Gene Symbol Or8b56
Ensembl Gene ENSMUSG00000044798
Gene Name olfactory receptor family 8 subfamily B member 56
Synonyms Olfr923, MOR164-2, GA_x6K02T2PVTD-32530445-32531380
MMRRC Submission 040453-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R2863 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38738911-38739978 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38739835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 283 (F283I)
Ref Sequence ENSEMBL: ENSMUSP00000151652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051238] [ENSMUST00000213619] [ENSMUST00000219798]
AlphaFold Q7TRB9
Predicted Effect possibly damaging
Transcript: ENSMUST00000051238
AA Change: F277I

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062073
Gene: ENSMUSG00000044798
AA Change: F277I

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 1.2e-46 PFAM
Pfam:7tm_1 47 296 3.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213550
Predicted Effect possibly damaging
Transcript: ENSMUST00000213619
AA Change: F277I

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219798
AA Change: F283I

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Armh3 A T 19: 45,874,396 (GRCm39) N592K probably damaging Het
Bag5 T C 12: 111,677,029 (GRCm39) T265A probably benign Het
Bmper A G 9: 23,395,237 (GRCm39) N656S probably benign Het
Boc A G 16: 44,313,323 (GRCm39) S514P probably benign Het
Ddx6 G T 9: 44,525,553 (GRCm39) L103F probably damaging Het
Epb41l3 C T 17: 69,517,316 (GRCm39) P115S probably benign Het
Exoc6 T C 19: 37,641,861 (GRCm39) F709S probably benign Het
Fnip1 T C 11: 54,393,250 (GRCm39) I562T probably damaging Het
Fxr2 T A 11: 69,530,253 (GRCm39) I40N probably damaging Het
Ifna6 G C 4: 88,746,099 (GRCm39) R149S probably benign Het
Ifna6 C A 4: 88,746,086 (GRCm39) T145K probably benign Het
Ldb2 T C 5: 44,637,666 (GRCm39) Q214R probably damaging Het
Mus81 T G 19: 5,536,528 (GRCm39) Y146S probably damaging Het
Myh11 T C 16: 14,057,290 (GRCm39) I335V probably benign Het
Nid2 G A 14: 19,818,471 (GRCm39) E322K possibly damaging Het
Odad1 T C 7: 45,597,736 (GRCm39) S549P probably benign Het
Ofcc1 A T 13: 40,226,236 (GRCm39) S765R probably damaging Het
Ofcc1 T A 13: 40,241,414 (GRCm39) H698L possibly damaging Het
Otog T G 7: 45,918,730 (GRCm39) C935W probably damaging Het
Pcdhga3 T C 18: 37,807,643 (GRCm39) V32A probably damaging Het
Phc3 C T 3: 30,968,277 (GRCm39) D920N probably damaging Het
Pou6f1 A G 15: 100,478,689 (GRCm39) probably null Het
Ppp4c A T 7: 126,391,272 (GRCm39) I20N probably damaging Het
Prkag2 T A 5: 25,226,790 (GRCm39) T156S probably benign Het
Psd T C 19: 46,303,201 (GRCm39) D95G probably damaging Het
Riox2 A G 16: 59,309,756 (GRCm39) D370G probably damaging Het
Spink14 T A 18: 44,163,948 (GRCm39) C39S probably damaging Het
Tdrd9 T C 12: 111,997,695 (GRCm39) V728A probably benign Het
Tgm2 T C 2: 157,985,019 (GRCm39) E29G probably benign Het
Wdr35 T A 12: 9,078,060 (GRCm39) Y1139* probably null Het
Wdr95 T A 5: 149,505,321 (GRCm39) C367* probably null Het
Zfp35 T A 18: 24,137,352 (GRCm39) D565E probably damaging Het
Other mutations in Or8b56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Or8b56 APN 9 38,739,895 (GRCm39) missense possibly damaging 0.93
IGL01521:Or8b56 APN 9 38,739,185 (GRCm39) missense probably damaging 1.00
IGL01548:Or8b56 APN 9 38,739,646 (GRCm39) missense probably benign 0.00
IGL02240:Or8b56 APN 9 38,739,602 (GRCm39) missense probably benign 0.12
IGL02794:Or8b56 APN 9 38,739,511 (GRCm39) missense probably damaging 1.00
R0116:Or8b56 UTSW 9 38,739,860 (GRCm39) missense probably damaging 0.99
R0118:Or8b56 UTSW 9 38,739,154 (GRCm39) missense possibly damaging 0.62
R0189:Or8b56 UTSW 9 38,739,111 (GRCm39) nonsense probably null
R1381:Or8b56 UTSW 9 38,739,634 (GRCm39) missense probably benign 0.04
R1512:Or8b56 UTSW 9 38,739,660 (GRCm39) nonsense probably null
R1702:Or8b56 UTSW 9 38,739,839 (GRCm39) missense probably damaging 1.00
R2357:Or8b56 UTSW 9 38,739,634 (GRCm39) missense probably benign 0.00
R2985:Or8b56 UTSW 9 38,739,406 (GRCm39) missense probably benign 0.05
R5475:Or8b56 UTSW 9 38,739,762 (GRCm39) missense possibly damaging 0.81
R5682:Or8b56 UTSW 9 38,739,424 (GRCm39) missense probably benign 0.00
R8243:Or8b56 UTSW 9 38,739,803 (GRCm39) missense
R8743:Or8b56 UTSW 9 38,738,995 (GRCm39) missense probably benign 0.08
R9182:Or8b56 UTSW 9 38,739,172 (GRCm39) missense probably damaging 1.00
R9563:Or8b56 UTSW 9 38,739,014 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGAACATTGTGGTGTCTAC -3'
(R):5'- GTTGTGAATAAAGCAAATCTGGCTC -3'

Sequencing Primer
(F):5'- GGTGTCTACCAGTACCACTTTTATC -3'
(R):5'- GCAAATCTGGCTCTAAATTAATGGAG -3'
Posted On 2014-12-04