Incidental Mutation 'R2864:Or8b43'
ID 253101
Institutional Source Beutler Lab
Gene Symbol Or8b43
Ensembl Gene ENSMUSG00000049334
Gene Name olfactory receptor family 8 subfamily B member 43
Synonyms GA_x6K02T2PVTD-32141623-32142552, MOR169-1, Olfr902
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R2864 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38360088-38361143 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38360684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 172 (N172S)
Ref Sequence ENSEMBL: ENSMUSP00000151061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050733] [ENSMUST00000213105]
AlphaFold E9Q6Z7
Predicted Effect possibly damaging
Transcript: ENSMUST00000050733
AA Change: N172S

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055975
Gene: ENSMUSG00000049334
AA Change: N172S

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.5e-48 PFAM
Pfam:7tm_1 41 289 1.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213105
AA Change: N172S

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap30 G T 1: 171,235,774 (GRCm39) G716V probably damaging Het
Crk T C 11: 75,594,211 (GRCm39) V266A probably damaging Het
Dock4 T A 12: 40,780,072 (GRCm39) F624L probably damaging Het
Fhod1 T C 8: 106,059,543 (GRCm39) K714R probably null Het
Flt1 T C 5: 147,531,431 (GRCm39) Q844R possibly damaging Het
Fn1 A G 1: 71,641,578 (GRCm39) V1656A probably damaging Het
Fnip1 T C 11: 54,393,250 (GRCm39) I562T probably damaging Het
Gm7168 A G 17: 14,170,117 (GRCm39) K495E probably benign Het
Igf2r T C 17: 12,905,611 (GRCm39) H2240R probably damaging Het
Itpr3 T C 17: 27,310,525 (GRCm39) V436A probably benign Het
Lrp1b G T 2: 40,765,007 (GRCm39) Q2826K possibly damaging Het
Lrrc37 A G 11: 103,431,744 (GRCm39) F1357S probably benign Het
Luc7l C A 17: 26,485,335 (GRCm39) Q112K probably damaging Het
Misp A G 10: 79,662,872 (GRCm39) K430E probably benign Het
Oprm1 T A 10: 6,744,226 (GRCm39) probably null Het
Paqr3 C T 5: 97,247,595 (GRCm39) R171H possibly damaging Het
Phc3 C T 3: 30,968,277 (GRCm39) D920N probably damaging Het
Pigk T C 3: 152,428,189 (GRCm39) V72A probably damaging Het
Prickle1 C T 15: 93,407,159 (GRCm39) G112R probably damaging Het
Rrbp1 T C 2: 143,799,557 (GRCm39) E1050G probably damaging Het
Vmn2r93 A T 17: 18,546,323 (GRCm39) I732F probably damaging Het
Xkr6 T C 14: 64,057,205 (GRCm39) L372P unknown Het
Zfp523 T C 17: 28,421,514 (GRCm39) V60A probably benign Het
Other mutations in Or8b43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01738:Or8b43 APN 9 38,360,942 (GRCm39) missense probably damaging 0.97
IGL02149:Or8b43 APN 9 38,360,693 (GRCm39) missense probably damaging 0.97
IGL02869:Or8b43 APN 9 38,360,489 (GRCm39) missense possibly damaging 0.75
IGL02945:Or8b43 APN 9 38,360,812 (GRCm39) missense probably benign 0.00
IGL03269:Or8b43 APN 9 38,360,197 (GRCm39) missense probably benign 0.13
R1955:Or8b43 UTSW 9 38,360,984 (GRCm39) missense probably benign 0.13
R2182:Or8b43 UTSW 9 38,360,420 (GRCm39) missense probably benign 0.21
R4423:Or8b43 UTSW 9 38,360,662 (GRCm39) missense probably benign 0.03
R4938:Or8b43 UTSW 9 38,360,679 (GRCm39) missense probably benign 0.10
R5537:Or8b43 UTSW 9 38,360,538 (GRCm39) nonsense probably null
R6645:Or8b43 UTSW 9 38,360,219 (GRCm39) missense probably damaging 1.00
R6861:Or8b43 UTSW 9 38,360,731 (GRCm39) missense probably damaging 1.00
R6951:Or8b43 UTSW 9 38,360,234 (GRCm39) missense probably benign 0.00
R7568:Or8b43 UTSW 9 38,360,942 (GRCm39) missense probably damaging 1.00
R9002:Or8b43 UTSW 9 38,360,171 (GRCm39) start codon destroyed probably null 1.00
R9071:Or8b43 UTSW 9 38,361,032 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TTTGTGCTGACGTCAATGGC -3'
(R):5'- CGATTATGTGGGAGCTGCAG -3'

Sequencing Primer
(F):5'- CTGACGTCAATGGCTTATGATC -3'
(R):5'- CTACCCTTAGAGGAACTTATGCGG -3'
Posted On 2014-12-04