Incidental Mutation 'R2871:Rps6kc1'
ID253674
Institutional Source Beutler Lab
Gene Symbol Rps6kc1
Ensembl Gene ENSMUSG00000089872
Gene Nameribosomal protein S6 kinase polypeptide 1
SynonymsRPK118
MMRRC Submission 040459-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2871 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location190700202-190911770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 190899569 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 48 (I48M)
Ref Sequence ENSEMBL: ENSMUSP00000125010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061611] [ENSMUST00000159066] [ENSMUST00000159367] [ENSMUST00000159624]
Predicted Effect probably damaging
Transcript: ENSMUST00000061611
AA Change: I48M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061769
Gene: ENSMUSG00000089872
AA Change: I48M

DomainStartEndE-ValueType
PX 9 128 1.26e-13 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
MIT 235 313 1.12e-20 SMART
low complexity region 317 332 N/A INTRINSIC
SCOP:d1apme_ 347 417 2e-5 SMART
low complexity region 443 454 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
Pfam:Pkinase 863 1046 4.4e-26 PFAM
Pfam:Pkinase_Tyr 876 1032 5.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159066
AA Change: I36M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124558
Gene: ENSMUSG00000089872
AA Change: I36M

DomainStartEndE-ValueType
PX 9 116 1.36e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159367
SMART Domains Protein: ENSMUSP00000124383
Gene: ENSMUSG00000089872

DomainStartEndE-ValueType
Blast:PX 9 50 4e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159624
AA Change: I48M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125010
Gene: ENSMUSG00000089872
AA Change: I48M

DomainStartEndE-ValueType
PX 9 128 1.26e-13 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
Pfam:MIT 238 299 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162692
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.4%
  • 20x: 72.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Akap8l G A 17: 32,338,442 T65I possibly damaging Het
Arid4a T A 12: 71,022,260 probably null Het
Armc2 C T 10: 41,966,700 probably null Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cfap54 A T 10: 92,921,419 F273I possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Ddrgk1 T A 2: 130,664,644 probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eml5 C T 12: 98,865,401 D433N probably damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gm813 A T 16: 58,613,979 I125K probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Grid2ip C A 5: 143,357,929 Q127K probably benign Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ighv2-2 G A 12: 113,588,498 T40I possibly damaging Het
Kcnk10 T A 12: 98,434,813 R520S probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Kpna7 T C 5: 144,993,935 T367A probably benign Het
Lpo A G 11: 87,816,524 I221T possibly damaging Het
Lrrn3 T C 12: 41,452,723 I532V probably benign Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mki67 G A 7: 135,708,149 P191L probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mroh2a C A 1: 88,255,565 L1292I probably damaging Het
Msh2 C A 17: 87,685,584 Q314K possibly damaging Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nlrp4b C T 7: 10,710,243 Q40* probably null Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Npas3 C T 12: 54,068,013 R542* probably null Het
Olfr1101 A T 2: 86,988,848 C109* probably null Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr45 A G 7: 140,691,285 I127V possibly damaging Het
Olfr71 C A 4: 43,706,458 V37L probably benign Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Pkp4 C A 2: 59,308,156 T250K probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Psmd13 A T 7: 140,887,055 T116S probably damaging Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Rnf6 T C 5: 146,210,405 Y601C probably benign Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vmn2r70 T A 7: 85,559,019 Y750F probably damaging Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Rps6kc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rps6kc1 APN 1 190773678 missense probably damaging 1.00
IGL01310:Rps6kc1 APN 1 190783625 missense probably benign 0.45
IGL01331:Rps6kc1 APN 1 190800352 missense possibly damaging 0.49
IGL01551:Rps6kc1 APN 1 190773640 missense possibly damaging 0.70
IGL01665:Rps6kc1 APN 1 190911657 missense possibly damaging 0.66
IGL02178:Rps6kc1 APN 1 190871836 missense possibly damaging 0.63
IGL02550:Rps6kc1 APN 1 190871862 missense probably damaging 1.00
IGL02986:Rps6kc1 APN 1 190834061 missense probably damaging 1.00
IGL03010:Rps6kc1 APN 1 190911606 nonsense probably null
IGL03087:Rps6kc1 APN 1 190871711 missense probably damaging 1.00
IGL03130:Rps6kc1 APN 1 190799811 missense probably damaging 1.00
IGL03264:Rps6kc1 APN 1 190871829 missense probably benign
IGL03386:Rps6kc1 APN 1 190799570 missense probably damaging 0.97
R0184:Rps6kc1 UTSW 1 190799093 missense probably null 1.00
R0280:Rps6kc1 UTSW 1 190809000 missense probably damaging 1.00
R0482:Rps6kc1 UTSW 1 190799430 missense probably benign 0.00
R0651:Rps6kc1 UTSW 1 190799496 missense possibly damaging 0.51
R0785:Rps6kc1 UTSW 1 190808945 missense probably damaging 1.00
R1398:Rps6kc1 UTSW 1 190800015 missense probably damaging 0.99
R1428:Rps6kc1 UTSW 1 190798726 missense probably damaging 1.00
R1484:Rps6kc1 UTSW 1 190799475 missense possibly damaging 0.63
R1536:Rps6kc1 UTSW 1 190871768 missense possibly damaging 0.89
R1709:Rps6kc1 UTSW 1 190800336 missense possibly damaging 0.72
R2060:Rps6kc1 UTSW 1 190810108 missense possibly damaging 0.94
R2153:Rps6kc1 UTSW 1 190798723 missense probably damaging 1.00
R2871:Rps6kc1 UTSW 1 190899569 missense probably damaging 1.00
R4177:Rps6kc1 UTSW 1 190800419 missense possibly damaging 0.92
R4231:Rps6kc1 UTSW 1 190808900 missense probably damaging 1.00
R4401:Rps6kc1 UTSW 1 190799958 missense probably benign 0.32
R4402:Rps6kc1 UTSW 1 190798605 intron probably benign
R4785:Rps6kc1 UTSW 1 190750188 missense probably benign 0.00
R4810:Rps6kc1 UTSW 1 190808963 missense probably damaging 1.00
R4858:Rps6kc1 UTSW 1 190800318 missense probably damaging 1.00
R4887:Rps6kc1 UTSW 1 190798694 missense probably benign 0.13
R4976:Rps6kc1 UTSW 1 190798727 missense probably damaging 0.99
R5134:Rps6kc1 UTSW 1 190773648 missense probably damaging 1.00
R5217:Rps6kc1 UTSW 1 190783605 missense probably damaging 1.00
R5350:Rps6kc1 UTSW 1 190799466 missense probably benign
R5952:Rps6kc1 UTSW 1 190885420 missense probably benign 0.05
R5979:Rps6kc1 UTSW 1 190800435 missense probably damaging 1.00
R6597:Rps6kc1 UTSW 1 190750184 missense probably benign 0.20
R7024:Rps6kc1 UTSW 1 190800210 missense probably benign 0.00
R7192:Rps6kc1 UTSW 1 190800359 missense probably damaging 0.98
R7423:Rps6kc1 UTSW 1 190799096 missense probably damaging 1.00
R7493:Rps6kc1 UTSW 1 190800057 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCAAGTGTGCGGTTCTCATG -3'
(R):5'- GTCAAATCAACAGCCTTAGGGAG -3'

Sequencing Primer
(F):5'- CAAGTGTGCGGTTCTCATGACATG -3'
(R):5'- CCTTAGGGAGAAGTGCTGC -3'
Posted On2014-12-04