Incidental Mutation 'R2516:Mmrn2'
ID253841
Institutional Source Beutler Lab
Gene Symbol Mmrn2
Ensembl Gene ENSMUSG00000041445
Gene Namemultimerin 2
SynonymsEmilin3, EndoGlyx-1, ENDOGLYX1
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R2516 (G1)
Quality Score178
Status Validated
Chromosome14
Chromosomal Location34375465-34404287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34398802 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 543 (M543K)
Ref Sequence ENSEMBL: ENSMUSP00000107539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111908]
Predicted Effect probably benign
Transcript: ENSMUST00000111908
AA Change: M543K

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107539
Gene: ENSMUSG00000041445
AA Change: M543K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 55 127 1.1e-15 PFAM
low complexity region 174 186 N/A INTRINSIC
low complexity region 356 362 N/A INTRINSIC
coiled coil region 387 480 N/A INTRINSIC
coiled coil region 533 583 N/A INTRINSIC
coiled coil region 688 715 N/A INTRINSIC
Pfam:C1q 821 940 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227130
Meta Mutation Damage Score 0.1656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transforming growth factor beta antagonist and can interfere with the VEGF-A/VEGFR2 pathway. A related pseudogene has been identified on chromosome 6. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Mmrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Mmrn2 APN 14 34403217 missense probably damaging 1.00
IGL02529:Mmrn2 APN 14 34398613 missense possibly damaging 0.74
IGL02590:Mmrn2 APN 14 34399267 nonsense probably null
P0037:Mmrn2 UTSW 14 34403065 missense probably damaging 1.00
R0323:Mmrn2 UTSW 14 34398034 missense probably damaging 0.97
R0499:Mmrn2 UTSW 14 34397956 missense probably damaging 1.00
R1073:Mmrn2 UTSW 14 34396294 critical splice donor site probably null
R1422:Mmrn2 UTSW 14 34396239 missense probably damaging 1.00
R1455:Mmrn2 UTSW 14 34399132 missense probably benign 0.00
R1584:Mmrn2 UTSW 14 34375685 missense probably benign 0.19
R1702:Mmrn2 UTSW 14 34397914 missense probably benign 0.34
R1919:Mmrn2 UTSW 14 34397643 missense probably benign 0.10
R1961:Mmrn2 UTSW 14 34398475 unclassified probably null
R2267:Mmrn2 UTSW 14 34399492 missense probably benign 0.41
R2268:Mmrn2 UTSW 14 34399492 missense probably benign 0.41
R2571:Mmrn2 UTSW 14 34402939 missense probably damaging 0.99
R2696:Mmrn2 UTSW 14 34398415 missense probably damaging 1.00
R2892:Mmrn2 UTSW 14 34396630 missense probably benign 0.01
R2919:Mmrn2 UTSW 14 34402922 missense possibly damaging 0.72
R3611:Mmrn2 UTSW 14 34398675 missense probably benign 0.00
R3898:Mmrn2 UTSW 14 34399560 unclassified probably null
R3899:Mmrn2 UTSW 14 34399560 unclassified probably null
R3900:Mmrn2 UTSW 14 34399560 unclassified probably null
R4363:Mmrn2 UTSW 14 34397977 missense probably damaging 0.99
R4392:Mmrn2 UTSW 14 34397616 missense probably damaging 1.00
R4510:Mmrn2 UTSW 14 34403059 missense possibly damaging 0.67
R4511:Mmrn2 UTSW 14 34403059 missense possibly damaging 0.67
R4993:Mmrn2 UTSW 14 34396398 missense probably damaging 1.00
R5026:Mmrn2 UTSW 14 34399201 missense probably benign 0.07
R5263:Mmrn2 UTSW 14 34399584 missense probably benign
R5478:Mmrn2 UTSW 14 34396582 missense probably benign 0.11
R5606:Mmrn2 UTSW 14 34397624 missense probably damaging 1.00
R6059:Mmrn2 UTSW 14 34397591 nonsense probably null
R6279:Mmrn2 UTSW 14 34397657 missense probably benign
R6300:Mmrn2 UTSW 14 34397657 missense probably benign
R6938:Mmrn2 UTSW 14 34398714 missense probably benign 0.22
X0064:Mmrn2 UTSW 14 34399152 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTACCCTGCAGCATCTG -3'
(R):5'- TATCATCTCCTCCCCGAAGAGTG -3'

Sequencing Primer
(F):5'- GCAGACCTCATTAAGTATGTCAAGG -3'
(R):5'- TCCCCGAAGAGTGCAGCTAG -3'
Posted On2014-12-04