Mutagenetix > Incidental Mutation

Incidental Mutation 'R2936:Nup155'

255030

Institutional Source

Beutler Lab

Gene Symbol

Nup155

Ensembl Gene

ENSMUSG00000022142

Gene Name

nucleoporin 155

Synonyms

D930027M19Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2936 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

8138757-8190731 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8172533 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 840 (S840P)

Ref Sequence

ENSEMBL: ENSMUSP00000128819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]

AlphaFold

Q99P88

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163765
AA Change: S840P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142
AA Change: S840P

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
Pfam:Nucleoporin_N	77	510	3.5e-105	PFAM
low complexity region	600	619	N/A	INTRINSIC
Pfam:Nucleoporin_C	678	1221	3.6e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229039

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230017
AA Change: S840P

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230337

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	A	T	18: 70,601,519 (GRCm39)	M121K	probably damaging	Het
Cacybp	A	T	1: 160,035,947 (GRCm39)		probably null	Het
Cd6	T	C	19: 10,773,686 (GRCm39)		probably null	Het
Cep162	T	C	9: 87,109,467 (GRCm39)	T379A	probably benign	Het
Gaa	T	C	11: 119,174,550 (GRCm39)	V799A	probably benign	Het
Gm16503	A	G	4: 147,625,704 (GRCm39)	D66G	unknown	Het
Hspa9	T	C	18: 35,081,067 (GRCm39)	T205A	probably damaging	Het
Ihh	A	G	1: 74,985,705 (GRCm39)	I260T	probably damaging	Het
Jcad	T	A	18: 4,675,153 (GRCm39)	Y972N	probably benign	Het
Magi2	A	AG	5: 20,807,459 (GRCm39)		probably null	Het
Mmp12	A	G	9: 7,357,819 (GRCm39)	Q341R	probably benign	Het
Or4l15	A	T	14: 50,197,611 (GRCm39)	V306E	probably benign	Het
Pde4b	C	T	4: 102,458,742 (GRCm39)	A466V	probably damaging	Het
Pde5a	A	G	3: 122,587,968 (GRCm39)	E378G	probably damaging	Het
Rad54l	T	C	4: 115,980,076 (GRCm39)		probably benign	Het
Stbd1	C	T	5: 92,751,119 (GRCm39)	P51L	possibly damaging	Het
Tent4a	G	A	13: 69,650,446 (GRCm39)	T621I	possibly damaging	Het
Tnfaip3	A	G	10: 18,887,357 (GRCm39)	F56S	probably damaging	Het
Tnr	A	C	1: 159,715,932 (GRCm39)	Y898S	probably damaging	Het
Trav6n-6	A	G	14: 53,370,341 (GRCm39)	T31A	probably benign	Het

Other mutations in Nup155

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Nup155	APN	15	8,150,939 (GRCm39)	splice site	probably benign
IGL00426:Nup155	APN	15	8,186,278 (GRCm39)	makesense	probably null
IGL00765:Nup155	APN	15	8,182,712 (GRCm39)	missense	probably benign	0.16
IGL00936:Nup155	APN	15	8,157,889 (GRCm39)	splice site	probably benign
IGL01124:Nup155	APN	15	8,183,163 (GRCm39)	missense	probably damaging	0.97
IGL01739:Nup155	APN	15	8,165,272 (GRCm39)	missense	probably benign	0.01
IGL02013:Nup155	APN	15	8,143,132 (GRCm39)	missense	possibly damaging	0.61
IGL02066:Nup155	APN	15	8,187,250 (GRCm39)	unclassified	probably benign
IGL02231:Nup155	APN	15	8,173,548 (GRCm39)	missense	probably damaging	1.00
IGL02246:Nup155	APN	15	8,172,486 (GRCm39)	missense	probably benign
IGL02289:Nup155	APN	15	8,160,977 (GRCm39)	missense	probably damaging	1.00
IGL02608:Nup155	APN	15	8,138,955 (GRCm39)	missense	probably benign
IGL02749:Nup155	APN	15	8,163,560 (GRCm39)	missense	probably damaging	1.00
IGL02813:Nup155	APN	15	8,159,605 (GRCm39)	splice site	probably benign
IGL03102:Nup155	APN	15	8,176,768 (GRCm39)	missense	probably benign	0.00
H8930:Nup155	UTSW	15	8,187,142 (GRCm39)	missense	possibly damaging	0.50
IGL02835:Nup155	UTSW	15	8,172,614 (GRCm39)	missense	probably damaging	1.00
R0314:Nup155	UTSW	15	8,176,736 (GRCm39)	missense	probably benign	0.00
R0365:Nup155	UTSW	15	8,161,027 (GRCm39)	missense	probably damaging	1.00
R0586:Nup155	UTSW	15	8,159,716 (GRCm39)	missense	probably benign	0.39
R0764:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R0839:Nup155	UTSW	15	8,175,071 (GRCm39)	missense	possibly damaging	0.48
R0844:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1066:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1067:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1085:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1137:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1162:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1166:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1202:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1203:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1219:Nup155	UTSW	15	8,146,822 (GRCm39)	missense	possibly damaging	0.80
R1385:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1421:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1448:Nup155	UTSW	15	8,141,890 (GRCm39)	missense	probably benign	0.44
R1611:Nup155	UTSW	15	8,159,644 (GRCm39)	missense	probably damaging	1.00
R1836:Nup155	UTSW	15	8,184,464 (GRCm39)	missense	possibly damaging	0.79
R1863:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1866:Nup155	UTSW	15	8,145,010 (GRCm39)	missense	probably damaging	1.00
R1894:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1976:Nup155	UTSW	15	8,165,311 (GRCm39)	missense	probably benign	0.01
R2024:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R2026:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R2027:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R2077:Nup155	UTSW	15	8,172,510 (GRCm39)	missense	probably damaging	1.00
R2111:Nup155	UTSW	15	8,150,951 (GRCm39)	missense	probably benign	0.45
R2921:Nup155	UTSW	15	8,183,125 (GRCm39)	missense	probably damaging	1.00
R3108:Nup155	UTSW	15	8,146,790 (GRCm39)	missense	probably null	1.00
R3161:Nup155	UTSW	15	8,177,867 (GRCm39)	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8,177,867 (GRCm39)	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8,177,867 (GRCm39)	missense	possibly damaging	0.56
R3522:Nup155	UTSW	15	8,186,162 (GRCm39)	splice site	probably benign
R4423:Nup155	UTSW	15	8,150,948 (GRCm39)	missense	probably damaging	0.99
R4451:Nup155	UTSW	15	8,180,366 (GRCm39)	missense	probably benign	0.02
R4498:Nup155	UTSW	15	8,183,157 (GRCm39)	missense	possibly damaging	0.88
R4780:Nup155	UTSW	15	8,187,187 (GRCm39)	missense	probably benign	0.00
R4822:Nup155	UTSW	15	8,158,010 (GRCm39)	missense	possibly damaging	0.49
R5013:Nup155	UTSW	15	8,153,722 (GRCm39)	missense	probably benign	0.00
R5064:Nup155	UTSW	15	8,165,354 (GRCm39)	missense	probably damaging	1.00
R5172:Nup155	UTSW	15	8,139,026 (GRCm39)	missense	probably benign	0.06
R5406:Nup155	UTSW	15	8,183,122 (GRCm39)	critical splice acceptor site	probably null
R5551:Nup155	UTSW	15	8,177,817 (GRCm39)	missense	probably benign	0.09
R5588:Nup155	UTSW	15	8,148,737 (GRCm39)	critical splice donor site	probably null
R5977:Nup155	UTSW	15	8,159,721 (GRCm39)	critical splice donor site	probably null
R6035:Nup155	UTSW	15	8,173,577 (GRCm39)	missense	probably benign
R6035:Nup155	UTSW	15	8,173,577 (GRCm39)	missense	probably benign
R6036:Nup155	UTSW	15	8,157,895 (GRCm39)	missense	probably benign	0.16
R6036:Nup155	UTSW	15	8,157,895 (GRCm39)	missense	probably benign	0.16
R6085:Nup155	UTSW	15	8,177,842 (GRCm39)	missense	probably damaging	0.98
R6188:Nup155	UTSW	15	8,139,059 (GRCm39)	missense	probably damaging	1.00
R6232:Nup155	UTSW	15	8,138,963 (GRCm39)	missense	probably benign	0.02
R6257:Nup155	UTSW	15	8,180,282 (GRCm39)	nonsense	probably null
R6262:Nup155	UTSW	15	8,186,225 (GRCm39)	missense	probably benign	0.03
R6267:Nup155	UTSW	15	8,182,639 (GRCm39)	missense	probably damaging	1.00
R6296:Nup155	UTSW	15	8,182,639 (GRCm39)	missense	probably damaging	1.00
R6299:Nup155	UTSW	15	8,157,922 (GRCm39)	missense	possibly damaging	0.88
R6303:Nup155	UTSW	15	8,147,526 (GRCm39)	missense	probably damaging	1.00
R6304:Nup155	UTSW	15	8,147,526 (GRCm39)	missense	probably damaging	1.00
R6763:Nup155	UTSW	15	8,165,379 (GRCm39)	nonsense	probably null
R6958:Nup155	UTSW	15	8,176,638 (GRCm39)	missense	probably damaging	1.00
R7088:Nup155	UTSW	15	8,186,177 (GRCm39)	missense	probably benign	0.11
R7313:Nup155	UTSW	15	8,184,406 (GRCm39)	missense	probably damaging	0.96
R7451:Nup155	UTSW	15	8,175,091 (GRCm39)	nonsense	probably null
R7560:Nup155	UTSW	15	8,184,531 (GRCm39)	missense	probably benign	0.39
R7633:Nup155	UTSW	15	8,138,937 (GRCm39)	missense	probably damaging	0.99
R7670:Nup155	UTSW	15	8,183,180 (GRCm39)	missense	probably damaging	0.99
R7726:Nup155	UTSW	15	8,151,623 (GRCm39)	missense	probably damaging	1.00
R7752:Nup155	UTSW	15	8,145,926 (GRCm39)	missense	possibly damaging	0.53
R7889:Nup155	UTSW	15	8,150,991 (GRCm39)	missense	probably damaging	0.98
R7899:Nup155	UTSW	15	8,148,663 (GRCm39)	missense	probably damaging	1.00
R7901:Nup155	UTSW	15	8,145,926 (GRCm39)	missense	possibly damaging	0.53
R8429:Nup155	UTSW	15	8,141,904 (GRCm39)	missense	probably damaging	0.96
R8467:Nup155	UTSW	15	8,151,015 (GRCm39)	missense	probably benign	0.00
R8507:Nup155	UTSW	15	8,177,044 (GRCm39)	nonsense	probably null
R8860:Nup155	UTSW	15	8,159,640 (GRCm39)	missense	possibly damaging	0.96
R8994:Nup155	UTSW	15	8,172,645 (GRCm39)	critical splice donor site	probably null
R9046:Nup155	UTSW	15	8,157,919 (GRCm39)	frame shift	probably null
R9086:Nup155	UTSW	15	8,177,830 (GRCm39)	missense	possibly damaging	0.84
R9500:Nup155	UTSW	15	8,141,800 (GRCm39)	missense	probably damaging	1.00
RF003:Nup155	UTSW	15	8,148,660 (GRCm39)	critical splice acceptor site	probably benign
RF048:Nup155	UTSW	15	8,148,660 (GRCm39)	critical splice acceptor site	probably benign
Z1177:Nup155	UTSW	15	8,149,973 (GRCm39)	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TGCTGGGAATCGAACCTCAG -3'
(R):5'- GGGAAAACCCTGATTCTCCACTC -3'

Sequencing Primer
(F):5'- GTGCTAACTAGTAAGACCCTGTC -3'
(R):5'- TCCCACTCATCACTATGAAGC -3'

Posted On

2014-12-29