Incidental Mutation 'R2910:Mbtps1'
ID261195
Institutional Source Beutler Lab
Gene Symbol Mbtps1
Ensembl Gene ENSMUSG00000031835
Gene Namemembrane-bound transcription factor peptidase, site 1
Synonymssubtilisin/kexin isozyme-1, SKI-1, site-1 protease, S1P, 0610038M03Rik
MMRRC Submission 040497-MU
Accession Numbers

ENSMUST00000098362; MGI: 1927235

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2910 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119508156-119558735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119546037 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 123 (I123T)
Ref Sequence ENSEMBL: ENSMUSP00000095965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081381] [ENSMUST00000098362]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081381
AA Change: I123T

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080117
Gene: ENSMUSG00000031835
AA Change: I123T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 209 464 1.5e-43 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098362
AA Change: I123T

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095965
Gene: ENSMUSG00000031835
AA Change: I123T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Peptidase_S8 213 473 3.7e-45 PFAM
transmembrane domain 1000 1022 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212813
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the cis/medial-Golgi where a second autocatalytic event takes place and the catalytic activity is acquired. It encodes a type 1 membrane bound protease which is ubiquitously expressed and regulates cholesterol or lipid homeostasis via cleavage of substrates at non-basic residues. Mutations in this gene may be associated with lysosomal dysfunction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. Mice homozygous for an ENU-induced allele exhibit hypopigmentation, reduced female fertility, altered lipid homeostasis, and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(3) Gene trapped(34) Chemically induced(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,608,426 Q189* probably null Het
Abcf3 A G 16: 20,560,232 T645A probably damaging Het
Acap1 A G 11: 69,887,076 probably benign Het
Adgrv1 G A 13: 81,557,119 A1524V possibly damaging Het
Agbl1 A G 7: 76,419,838 N121D probably benign Het
Ahnak A G 19: 9,011,654 D3434G probably damaging Het
Ankrd11 A T 8: 122,908,798 D32E probably damaging Het
Asxl1 T C 2: 153,401,039 S1170P probably benign Het
Atp8b3 G A 10: 80,519,912 S1322F possibly damaging Het
Car15 G A 16: 17,838,142 probably benign Het
Cep104 T A 4: 153,995,427 probably null Het
Cnnm1 A G 19: 43,469,647 I633V possibly damaging Het
Cog8 A T 8: 107,054,221 V135E probably benign Het
Cts6 A G 13: 61,196,401 V279A probably damaging Het
Ddx1 C T 12: 13,231,440 probably null Het
Dock2 A G 11: 34,232,910 probably benign Het
Ero1lb T A 13: 12,600,289 D336E probably damaging Het
F11 C G 8: 45,241,449 *625S probably null Het
F5 A G 1: 164,204,820 M1779V probably benign Het
Fam227a A T 15: 79,636,734 D296E possibly damaging Het
Fbxo38 T C 18: 62,519,807 D523G probably benign Het
Ggt1 G A 10: 75,580,596 V275M probably benign Het
Gm379 A C X: 108,664,765 F43V possibly damaging Het
Grhl3 T C 4: 135,559,146 I75V probably benign Het
Iqcm A T 8: 75,714,776 I226F probably benign Het
Kcnq1 T G 7: 143,425,962 L615R probably damaging Het
Lcp2 G A 11: 34,068,970 probably null Het
Muc5ac C T 7: 141,807,641 T1563I probably damaging Het
Odf2l A C 3: 145,124,323 I19L probably benign Het
Olfr193 C T 16: 59,110,181 R143H probably benign Het
Olfr993 T A 2: 85,414,351 H176L probably damaging Het
Pigr A G 1: 130,849,533 D692G probably damaging Het
Pkd1l3 A G 8: 109,667,636 probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Reep2 T C 18: 34,845,690 probably null Het
Rubcnl C T 14: 75,040,808 T344I probably benign Het
Sema6d C A 2: 124,665,037 P941T probably damaging Het
Shcbp1l C A 1: 153,428,626 L144I probably damaging Het
Slc7a1 T C 5: 148,352,257 E60G probably benign Het
Snx2 C T 18: 53,199,874 P207S probably damaging Het
Spata31 T G 13: 64,920,436 S133A probably benign Het
Tac1 A G 6: 7,559,097 probably null Het
Tfpi A C 2: 84,444,093 V184G possibly damaging Het
Tmeff1 C A 4: 48,614,961 N139K possibly damaging Het
Tnxb A G 17: 34,672,450 D589G probably damaging Het
Trpc1 C A 9: 95,749,842 A16S probably benign Het
Vmn2r106 A C 17: 20,278,684 L322V probably damaging Het
Vmn2r69 G T 7: 85,406,710 A740D probably damaging Het
Other mutations in Mbtps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
muskrat UTSW 8 119538137 missense probably damaging 1.00
packrat UTSW 8 119528961 missense probably damaging 1.00
woodrat UTSW 8 119529030 missense probably damaging 1.00
R0194:Mbtps1 UTSW 8 119535369 missense probably damaging 1.00
R0270:Mbtps1 UTSW 8 119538117 splice site probably benign
R0485:Mbtps1 UTSW 8 119522601 splice site probably benign
R1269:Mbtps1 UTSW 8 119520277 missense probably damaging 1.00
R1351:Mbtps1 UTSW 8 119518162 missense possibly damaging 0.95
R1536:Mbtps1 UTSW 8 119546125 missense probably benign 0.01
R1542:Mbtps1 UTSW 8 119546247 splice site probably null
R1543:Mbtps1 UTSW 8 119542069 splice site probably benign
R1580:Mbtps1 UTSW 8 119538900 missense possibly damaging 0.79
R1587:Mbtps1 UTSW 8 119518219 missense probably damaging 0.96
R1715:Mbtps1 UTSW 8 119542730 missense probably benign 0.40
R1845:Mbtps1 UTSW 8 119522493 missense probably benign 0.13
R2147:Mbtps1 UTSW 8 119538859 missense probably benign 0.01
R2157:Mbtps1 UTSW 8 119542727 missense probably benign 0.01
R2416:Mbtps1 UTSW 8 119538917 missense probably damaging 1.00
R2911:Mbtps1 UTSW 8 119546037 missense possibly damaging 0.82
R3079:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3079:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R3080:Mbtps1 UTSW 8 119531205 missense probably benign 0.40
R3080:Mbtps1 UTSW 8 119538863 missense probably damaging 1.00
R4116:Mbtps1 UTSW 8 119541652 missense probably benign 0.00
R4296:Mbtps1 UTSW 8 119522499 missense possibly damaging 0.95
R4602:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4603:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4610:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4611:Mbtps1 UTSW 8 119535347 missense probably damaging 1.00
R4729:Mbtps1 UTSW 8 119525420 missense probably damaging 1.00
R4868:Mbtps1 UTSW 8 119508928 missense probably benign 0.01
R4893:Mbtps1 UTSW 8 119518193 missense probably damaging 1.00
R4999:Mbtps1 UTSW 8 119533348 missense probably damaging 1.00
R6056:Mbtps1 UTSW 8 119515602 missense probably benign
R6062:Mbtps1 UTSW 8 119531091 missense possibly damaging 0.94
R6237:Mbtps1 UTSW 8 119528961 missense probably damaging 1.00
R6617:Mbtps1 UTSW 8 119538137 missense probably damaging 1.00
R7215:Mbtps1 UTSW 8 119524568 missense possibly damaging 0.82
R7275:Mbtps1 UTSW 8 119542750 missense probably benign
X0017:Mbtps1 UTSW 8 119531124 missense probably damaging 1.00
X0027:Mbtps1 UTSW 8 119522547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCTGTCAAGACAACATTC -3'
(R):5'- CTCAATGGAGGTTCAGAGTAGG -3'

Sequencing Primer
(F):5'- TGTCAAGACAACATTCTCCACTAGAG -3'
(R):5'- GTGGCTTTCAACGGATACTTCACAG -3'
Posted On2015-01-23