Incidental Mutation 'R3106:Hist1h1c'
ID263073
Institutional Source Beutler Lab
Gene Symbol Hist1h1c
Ensembl Gene ENSMUSG00000036181
Gene Namehistone cluster 1, H1c
SynonymsH1.2, H1var1, H1f2, 0610008C09Rik, H1c
MMRRC Submission 040580-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3106 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23738808-23740367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23738900 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 18 (A18S)
Ref Sequence ENSEMBL: ENSMUSP00000045816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040914]
Predicted Effect unknown
Transcript: ENSMUST00000040914
AA Change: A18S
SMART Domains Protein: ENSMUSP00000045816
Gene: ENSMUSG00000036181
AA Change: A18S

DomainStartEndE-ValueType
low complexity region 3 29 N/A INTRINSIC
H15 34 99 2.8e-22 SMART
low complexity region 116 212 N/A INTRINSIC
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations are normal, but Hist1h1c/Hist1h1e double knockout males are significantly smaller than normal. The Hist1h1c/Hist1h1e/Hist1h1d triple knockout is lethal by embryonic day 12.5, and heterozygotes are underrepresented. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,396,633 E1331V possibly damaging Het
Adam22 A G 5: 8,117,583 probably null Het
Adamts17 T A 7: 67,125,072 S980T probably damaging Het
Adarb1 C A 10: 77,321,757 K285N probably damaging Het
Atp5c1 A G 2: 10,063,465 S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Btf3 T G 13: 98,310,988 E145D probably benign Het
Ccdc184 G T 15: 98,168,601 A96S probably damaging Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Ceacam5 T C 7: 17,747,323 Y332H probably benign Het
Clip2 T C 5: 134,523,064 K68R probably benign Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Dennd3 C A 15: 73,565,124 S118* probably null Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dzip1l A T 9: 99,642,572 K249* probably null Het
Dzip1l A G 9: 99,647,121 E301G probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gm13119 T C 4: 144,361,676 V14A probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lemd2 C A 17: 27,201,670 L256F probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1136 T C 2: 87,693,505 I126V probably damaging Het
Olfr1284 A G 2: 111,379,495 N165S probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pan3 T C 5: 147,539,379 probably benign Het
Pld3 A G 7: 27,535,787 probably null Het
Plekha7 C T 7: 116,164,404 R321K probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Ptpn20 A G 14: 33,612,296 I44V probably benign Het
Ptprj T A 2: 90,440,631 H1251L probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Trp53bp1 A G 2: 121,236,652 L531S probably damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn2r-ps159 T A 4: 156,333,435 noncoding transcript Het
Wdr19 T C 5: 65,202,623 S24P probably benign Het
Other mutations in Hist1h1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Hist1h1c APN 13 23738845 utr 5 prime probably benign
R0234:Hist1h1c UTSW 13 23739123 missense probably benign 0.03
R0234:Hist1h1c UTSW 13 23739123 missense probably benign 0.03
R1954:Hist1h1c UTSW 13 23739402 missense unknown
R2008:Hist1h1c UTSW 13 23739409 missense probably benign 0.23
R2281:Hist1h1c UTSW 13 23738924 missense probably benign 0.23
R5560:Hist1h1c UTSW 13 23739407 missense probably benign 0.23
R5688:Hist1h1c UTSW 13 23739165 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAAACACAAGTTGGGCGCAG -3'
(R):5'- TCTTCAGGCCGAGCTTGATG -3'

Sequencing Primer
(F):5'- CTGCTCAGAGCTTGCCAG -3'
(R):5'- GATGCGGCTGTTGTTCTTCTCC -3'
Posted On2015-02-05