Incidental Mutation 'R3106:Pld3'
ID263056
Institutional Source Beutler Lab
Gene Symbol Pld3
Ensembl Gene ENSMUSG00000003363
Gene Namephospholipase D family, member 3
SynonymsSam-9
MMRRC Submission 040580-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3106 (G1)
Quality Score222
Status Validated
Chromosome7
Chromosomal Location27532000-27553218 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 27535787 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037134] [ENSMUST00000108353] [ENSMUST00000117095] [ENSMUST00000117611] [ENSMUST00000131106]
Predicted Effect probably benign
Transcript: ENSMUST00000037134
SMART Domains Protein: ENSMUSP00000043175
Gene: ENSMUSG00000040424

DomainStartEndE-ValueType
SCOP:d1howa_ 1 142 8e-12 SMART
Blast:S_TKc 1 143 8e-99 BLAST
PDB:3ANR|D 1 155 1e-12 PDB
low complexity region 192 206 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108353
SMART Domains Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424

DomainStartEndE-ValueType
S_TKc 11 347 9.31e-74 SMART
low complexity region 396 410 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117095
SMART Domains Protein: ENSMUSP00000113820
Gene: ENSMUSG00000003363

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
Pfam:PLDc_3 224 401 1.6e-43 PFAM
PLDc 409 435 1.19e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117611
SMART Domains Protein: ENSMUSP00000112942
Gene: ENSMUSG00000003363

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
PLDc 194 221 9.25e-10 SMART
low complexity region 285 297 N/A INTRINSIC
PLDc 409 435 1.19e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155287
Meta Mutation Damage Score 0.478 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phospholipase D (PLD) family of enzymes that catalyze the hydrolysis of membrane phospholipids. The encoded protein is a single-pass type II membrane protein and contains two PLD phosphodiesterase domains. This protein influences processing of amyloid-beta precursor protein. Mutations in this gene are associated with Alzheimer disease risk. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,396,633 E1331V possibly damaging Het
Adam22 A G 5: 8,117,583 probably null Het
Adamts17 T A 7: 67,125,072 S980T probably damaging Het
Adarb1 C A 10: 77,321,757 K285N probably damaging Het
Atp5c1 A G 2: 10,063,465 S160P probably benign Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Btf3 T G 13: 98,310,988 E145D probably benign Het
Ccdc184 G T 15: 98,168,601 A96S probably damaging Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Ceacam5 T C 7: 17,747,323 Y332H probably benign Het
Clip2 T C 5: 134,523,064 K68R probably benign Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Dennd3 C A 15: 73,565,124 S118* probably null Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dzip1l A T 9: 99,642,572 K249* probably null Het
Dzip1l A G 9: 99,647,121 E301G probably benign Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Ezh1 A C 11: 101,195,642 C575W probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gm13119 T C 4: 144,361,676 V14A probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Hist1h1c G T 13: 23,738,900 A18S unknown Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Lemd2 C A 17: 27,201,670 L256F probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1136 T C 2: 87,693,505 I126V probably damaging Het
Olfr1284 A G 2: 111,379,495 N165S probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pan3 T C 5: 147,539,379 probably benign Het
Plekha7 C T 7: 116,164,404 R321K probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Ptpn20 A G 14: 33,612,296 I44V probably benign Het
Ptprj T A 2: 90,440,631 H1251L probably damaging Het
Sbspon T C 1: 15,892,582 E24G probably benign Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Trp53bp1 A G 2: 121,236,652 L531S probably damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Vmn2r-ps159 T A 4: 156,333,435 noncoding transcript Het
Wdr19 T C 5: 65,202,623 S24P probably benign Het
Other mutations in Pld3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Pld3 APN 7 27532619 missense probably damaging 1.00
R0624:Pld3 UTSW 7 27539575 missense possibly damaging 0.94
R1384:Pld3 UTSW 7 27537657 missense probably benign 0.00
R1845:Pld3 UTSW 7 27539452 missense probably benign 0.01
R2235:Pld3 UTSW 7 27541107 missense probably benign 0.00
R5141:Pld3 UTSW 7 27533795 missense probably damaging 1.00
R5486:Pld3 UTSW 7 27533731 missense probably damaging 0.99
R5518:Pld3 UTSW 7 27532371 missense probably damaging 1.00
R5868:Pld3 UTSW 7 27537668 missense probably benign 0.00
R6446:Pld3 UTSW 7 27537731 missense probably damaging 1.00
R6591:Pld3 UTSW 7 27532316 missense probably benign 0.00
R6691:Pld3 UTSW 7 27532316 missense probably benign 0.00
R6823:Pld3 UTSW 7 27535897 missense probably damaging 1.00
R7162:Pld3 UTSW 7 27532474 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTAGCAACTGAGCCTGG -3'
(R):5'- TGCCTGCTTCATGGTGAATTATC -3'

Sequencing Primer
(F):5'- AGCCTGGAGCCTCTAGTATTTTAAGC -3'
(R):5'- TGGAATCCACTGTGACACTG -3'
Posted On2015-02-05