Incidental Mutation 'R0324:Aatf'
| ID |
26373 |
| Institutional Source |
Beutler Lab
|
| Gene Symbol |
Aatf
|
| Ensembl Gene |
ENSMUSG00000018697 |
| Gene Name |
apoptosis antagonizing transcription factor |
| Synonyms |
5830465M17Rik, Trb, 4933415H02Rik, Che-1 |
| MMRRC Submission |
038534-MU
|
| Accession Numbers |
|
| Essential gene? |
Essential
(E-score: 1.000)
|
| Stock # |
R0324 (G1)
|
| Quality Score |
225 |
|
Status
|
Not validated
|
| Chromosome |
11 |
| Chromosomal Location |
84313681-84404348 bp(-) (GRCm39) |
| Type of Mutation |
critical splice donor site (2 bp from exon) |
| DNA Base Change (assembly) |
A to G
at 84402965 bp (GRCm39)
|
| Zygosity |
Heterozygous |
| Amino Acid Change |
|
| Ref Sequence |
ENSEMBL: ENSMUSP00000018841
(fasta)
|
| Gene Model |
predicted gene model for transcript(s):
[ENSMUST00000018841]
|
| AlphaFold |
Q9JKX4 |
| Predicted Effect |
probably null
Transcript: ENSMUST00000018841
|
| SMART Domains |
Protein: ENSMUSP00000018841
Gene: ENSMUSG00000018697
| Domain | Start | End | E-Value | Type |
|---|
|
low complexity region
|
2 |
35 |
N/A |
INTRINSIC |
|
low complexity region
|
91 |
119 |
N/A |
INTRINSIC |
|
low complexity region
|
130 |
173 |
N/A |
INTRINSIC |
|
Pfam:AATF-Che1
|
187 |
339 |
4.6e-40 |
PFAM |
|
low complexity region
|
418 |
429 |
N/A |
INTRINSIC |
|
Pfam:TRAUB
|
430 |
514 |
3.2e-29 |
PFAM |
|
| Predicted Effect |
noncoding transcript
Transcript: ENSMUST00000148434
|
| Coding Region Coverage |
- 1x: 99.0%
- 3x: 98.1%
- 10x: 96.1%
- 20x: 93.1%
|
| Validation Efficiency |
|
| MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos do not develop past the compacted morula stage, and after failing to maintain compaction. Mutant embryos show abnormal morphology at E3.5, with most not forming a blastocoel cavity. Severely reduced cell proliferation is observed before blastocyst formation. [provided by MGI curators]
|
| Allele List at MGI |
All alleles(20) : Targeted(2) Gene trapped(18)
|
| Other mutations in this stock |
Total: 76 list
| Gene | Ref | Var | Chr/Loc | Mutation | Predicted Effect | Zygosity |
|---|
| 1700010I14Rik |
T |
C |
17: 9,219,989 (GRCm39) |
L357S |
probably benign |
Het |
| 1700129C05Rik |
C |
T |
14: 59,380,256 (GRCm39) |
R14H |
probably damaging |
Het |
| Abca13 |
T |
A |
11: 9,247,669 (GRCm39) |
M2472K |
possibly damaging |
Het |
| Abcd3 |
C |
A |
3: 121,562,816 (GRCm39) |
Q540H |
probably null |
Het |
| Adam17 |
C |
T |
12: 21,399,939 (GRCm39) |
V156I |
probably benign |
Het |
| Adam26a |
A |
G |
8: 44,021,490 (GRCm39) |
S667P |
probably benign |
Het |
| Adcy10 |
A |
G |
1: 165,391,818 (GRCm39) |
K1333E |
probably benign |
Het |
| Apob |
G |
A |
12: 8,060,521 (GRCm39) |
R2968Q |
probably benign |
Het |
| Arap3 |
G |
A |
18: 38,106,278 (GRCm39) |
P1522S |
possibly damaging |
Het |
| Catsper1 |
A |
T |
19: 5,386,573 (GRCm39) |
S269C |
probably damaging |
Het |
| Cd209d |
A |
T |
8: 3,928,258 (GRCm39) |
S42R |
probably benign |
Het |
| Cntln |
T |
A |
4: 85,010,932 (GRCm39) |
V1049E |
probably damaging |
Het |
| Cracr2b |
T |
C |
7: 141,043,659 (GRCm39) |
F87L |
probably damaging |
Het |
| Crb3 |
T |
C |
17: 57,372,133 (GRCm39) |
L60P |
probably damaging |
Het |
| Crispld1 |
T |
C |
1: 17,819,815 (GRCm39) |
V271A |
probably benign |
Het |
| Cyp2c66 |
G |
T |
19: 39,165,135 (GRCm39) |
R372L |
probably benign |
Het |
| Deup1 |
G |
A |
9: 15,493,829 (GRCm39) |
R438W |
probably benign |
Het |
| Dnah6 |
C |
T |
6: 73,150,541 (GRCm39) |
E741K |
possibly damaging |
Het |
| Epha4 |
T |
C |
1: 77,360,188 (GRCm39) |
E703G |
probably damaging |
Het |
| Evc2 |
G |
A |
5: 37,550,443 (GRCm39) |
R819H |
probably damaging |
Het |
| Fam217a |
A |
C |
13: 35,094,944 (GRCm39) |
C272G |
possibly damaging |
Het |
| Fndc7 |
T |
C |
3: 108,784,015 (GRCm39) |
|
probably null |
Het |
| Foxs1 |
C |
T |
2: 152,774,607 (GRCm39) |
G149S |
probably benign |
Het |
| Galnt13 |
T |
C |
2: 54,744,628 (GRCm39) |
V109A |
probably benign |
Het |
| Hmgxb4 |
G |
A |
8: 75,725,556 (GRCm39) |
M7I |
probably benign |
Het |
| Klk1b1 |
T |
A |
7: 43,620,165 (GRCm39) |
C209* |
probably null |
Het |
| Klra10 |
A |
G |
6: 130,249,613 (GRCm39) |
|
probably null |
Het |
| Kntc1 |
A |
T |
5: 123,916,175 (GRCm39) |
K701N |
probably damaging |
Het |
| Lpgat1 |
T |
A |
1: 191,481,754 (GRCm39) |
L114Q |
probably damaging |
Het |
| Mecom |
T |
A |
3: 30,017,261 (GRCm39) |
Q468L |
probably damaging |
Het |
| Med15 |
T |
C |
16: 17,515,476 (GRCm39) |
T70A |
probably damaging |
Het |
| Msh6 |
T |
A |
17: 88,294,048 (GRCm39) |
Y934* |
probably null |
Het |
| Mtus1 |
T |
C |
8: 41,537,432 (GRCm39) |
T95A |
probably benign |
Het |
| Mylk3 |
C |
A |
8: 86,079,535 (GRCm39) |
R444S |
probably damaging |
Het |
| Nbea |
A |
G |
3: 55,965,369 (GRCm39) |
|
probably null |
Het |
| Nbeal1 |
T |
C |
1: 60,332,032 (GRCm39) |
V2242A |
probably damaging |
Het |
| Nhp2 |
A |
G |
11: 51,513,334 (GRCm39) |
T85A |
possibly damaging |
Het |
| Nlk |
A |
G |
11: 78,463,257 (GRCm39) |
S413P |
possibly damaging |
Het |
| Nmbr |
A |
G |
10: 14,636,192 (GRCm39) |
I54V |
possibly damaging |
Het |
| Nmur2 |
A |
T |
11: 55,931,346 (GRCm39) |
C122S |
probably damaging |
Het |
| Nudt13 |
G |
T |
14: 20,361,583 (GRCm39) |
V220L |
probably damaging |
Het |
| Or5m13 |
G |
A |
2: 85,748,295 (GRCm39) |
V9M |
probably benign |
Het |
| Pclo |
G |
A |
5: 14,719,447 (GRCm39) |
G1195R |
unknown |
Het |
| Pcsk7 |
A |
G |
9: 45,824,309 (GRCm39) |
H276R |
possibly damaging |
Het |
| Pdss2 |
T |
C |
10: 43,269,924 (GRCm39) |
S256P |
probably damaging |
Het |
| Pgf |
G |
T |
12: 85,218,198 (GRCm39) |
H116N |
probably benign |
Het |
| Pglyrp2 |
T |
C |
17: 32,637,302 (GRCm39) |
D242G |
probably benign |
Het |
| Plk2 |
G |
A |
13: 110,534,242 (GRCm39) |
R274K |
probably benign |
Het |
| Ppp6r3 |
G |
T |
19: 3,514,693 (GRCm39) |
P141T |
probably benign |
Het |
| Prss54 |
T |
C |
8: 96,292,295 (GRCm39) |
T95A |
probably benign |
Het |
| Rab3il1 |
A |
G |
19: 10,005,653 (GRCm39) |
D149G |
probably damaging |
Het |
| Rasgef1c |
T |
C |
11: 49,852,057 (GRCm39) |
|
probably null |
Het |
| Rhpn1 |
T |
C |
15: 75,583,437 (GRCm39) |
M334T |
probably damaging |
Het |
| Rigi |
T |
C |
4: 40,213,766 (GRCm39) |
T586A |
probably benign |
Het |
| Robo2 |
C |
T |
16: 73,764,739 (GRCm39) |
V630M |
probably damaging |
Het |
| Rptor |
C |
T |
11: 119,783,467 (GRCm39) |
R1154W |
probably damaging |
Het |
| Scnn1g |
A |
G |
7: 121,339,778 (GRCm39) |
I192M |
possibly damaging |
Het |
| Sit1 |
G |
A |
4: 43,482,815 (GRCm39) |
Q115* |
probably null |
Het |
| Slc13a2 |
T |
C |
11: 78,295,350 (GRCm39) |
N141S |
probably damaging |
Het |
| Slc19a2 |
C |
A |
1: 164,084,344 (GRCm39) |
T78K |
probably damaging |
Het |
| Snx14 |
A |
G |
9: 88,287,291 (GRCm39) |
|
probably null |
Het |
| Stil |
T |
A |
4: 114,896,346 (GRCm39) |
C944S |
probably benign |
Het |
| Tex56 |
A |
G |
13: 35,108,596 (GRCm39) |
N26S |
probably benign |
Het |
| Tnfaip2 |
A |
G |
12: 111,419,893 (GRCm39) |
N675S |
probably damaging |
Het |
| Trim30c |
A |
G |
7: 104,032,516 (GRCm39) |
I270T |
possibly damaging |
Het |
| Ugt2a3 |
C |
T |
5: 87,474,932 (GRCm39) |
|
probably null |
Het |
| Vmn1r213 |
A |
T |
13: 23,195,588 (GRCm39) |
|
probably benign |
Het |
| Vmn2r8 |
A |
C |
5: 108,945,807 (GRCm39) |
|
probably null |
Het |
| Vps13c |
T |
C |
9: 67,871,591 (GRCm39) |
F3253L |
possibly damaging |
Het |
| Zbtb16 |
G |
T |
9: 48,576,575 (GRCm39) |
Q502K |
possibly damaging |
Het |
| Zfp143 |
A |
G |
7: 109,676,354 (GRCm39) |
K218E |
possibly damaging |
Het |
| Zfp946 |
A |
G |
17: 22,673,417 (GRCm39) |
N57S |
probably benign |
Het |
| Zfp985 |
T |
C |
4: 147,667,314 (GRCm39) |
Y61H |
probably benign |
Het |
| Zkscan1 |
G |
A |
5: 138,095,785 (GRCm39) |
R246Q |
probably damaging |
Het |
| Zpld1 |
A |
G |
16: 55,071,978 (GRCm39) |
F94L |
probably damaging |
Het |
| Zswim5 |
G |
T |
4: 116,844,103 (GRCm39) |
W1047L |
probably damaging |
Het |
|
| Other mutations in Aatf |
| Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
|---|
|
IGL00900:Aatf
|
APN |
11 |
84,361,383 (GRCm39) |
splice site |
probably benign |
|
|
IGL01482:Aatf
|
APN |
11 |
84,361,536 (GRCm39) |
missense |
possibly damaging |
0.51 |
|
IGL01775:Aatf
|
APN |
11 |
84,361,963 (GRCm39) |
missense |
probably damaging |
1.00 |
|
IGL02881:Aatf
|
APN |
11 |
84,362,115 (GRCm39) |
splice site |
probably benign |
|
|
R0183:Aatf
|
UTSW |
11 |
84,401,251 (GRCm39) |
splice site |
probably null |
|
|
R0200:Aatf
|
UTSW |
11 |
84,336,502 (GRCm39) |
missense |
probably damaging |
1.00 |
|
R0257:Aatf
|
UTSW |
11 |
84,401,107 (GRCm39) |
missense |
probably benign |
0.33 |
|
R0494:Aatf
|
UTSW |
11 |
84,402,339 (GRCm39) |
missense |
probably benign |
|
|
R0544:Aatf
|
UTSW |
11 |
84,313,831 (GRCm39) |
missense |
probably benign |
0.09 |
|
R1186:Aatf
|
UTSW |
11 |
84,361,375 (GRCm39) |
splice site |
probably benign |
|
|
R2339:Aatf
|
UTSW |
11 |
84,402,323 (GRCm39) |
missense |
probably benign |
0.00 |
|
R4626:Aatf
|
UTSW |
11 |
84,313,784 (GRCm39) |
makesense |
probably null |
|
|
R4647:Aatf
|
UTSW |
11 |
84,362,023 (GRCm39) |
missense |
possibly damaging |
0.69 |
|
R4697:Aatf
|
UTSW |
11 |
84,339,964 (GRCm39) |
missense |
probably damaging |
1.00 |
|
R4981:Aatf
|
UTSW |
11 |
84,402,323 (GRCm39) |
missense |
probably benign |
0.00 |
|
R5490:Aatf
|
UTSW |
11 |
84,401,099 (GRCm39) |
missense |
probably damaging |
1.00 |
|
R5938:Aatf
|
UTSW |
11 |
84,333,400 (GRCm39) |
missense |
possibly damaging |
0.88 |
|
R6267:Aatf
|
UTSW |
11 |
84,363,926 (GRCm39) |
missense |
probably benign |
0.09 |
|
R6296:Aatf
|
UTSW |
11 |
84,363,926 (GRCm39) |
missense |
probably benign |
0.09 |
|
R6633:Aatf
|
UTSW |
11 |
84,402,308 (GRCm39) |
critical splice donor site |
probably null |
|
|
R7081:Aatf
|
UTSW |
11 |
84,361,951 (GRCm39) |
missense |
possibly damaging |
0.84 |
|
R7212:Aatf
|
UTSW |
11 |
84,340,006 (GRCm39) |
missense |
probably damaging |
0.98 |
|
R7545:Aatf
|
UTSW |
11 |
84,361,502 (GRCm39) |
missense |
probably benign |
0.04 |
|
R7754:Aatf
|
UTSW |
11 |
84,402,335 (GRCm39) |
missense |
possibly damaging |
0.53 |
|
R7871:Aatf
|
UTSW |
11 |
84,361,864 (GRCm39) |
frame shift |
probably null |
|
|
R8411:Aatf
|
UTSW |
11 |
84,361,502 (GRCm39) |
missense |
probably benign |
0.04 |
|
R8746:Aatf
|
UTSW |
11 |
84,402,338 (GRCm39) |
missense |
probably benign |
0.06 |
|
R9406:Aatf
|
UTSW |
11 |
84,361,866 (GRCm39) |
frame shift |
probably null |
|
|
X0018:Aatf
|
UTSW |
11 |
84,401,211 (GRCm39) |
missense |
possibly damaging |
0.85 |
|
Z1176:Aatf
|
UTSW |
11 |
84,333,411 (GRCm39) |
missense |
probably benign |
0.01 |
|
| Predicted Primers |
PCR Primer
(F):5'- ACCAGGCCACATCTTTCATTCCAG -3'
(R):5'- GCCACTAGAGCCAGAGTGATTGAC -3'
Sequencing Primer
(F):5'- agccatctctccagccc -3'
(R):5'- CCAGAGTGATTGACAGGTTTGATG -3'
|
| Protein Function and Prediction |
Aatf encodes apoptosis-antagonizing transcription factor (AATF; alternatively Che-1 or Traube (Trb)), a nuclear protein that regulates gene transcription and cell proliferation. AATF has a leucine zipper motif, three nuclear receptor-binding LxxLL consensus sequences, and two N-terminal acidic domains (1;2). AATF is essential for preimplantation development.
|
| Expression/Localization |
AATF is expressed at high levels in the heart, skeletal muscle, and testis, and at lower levels in all other tissues analyzed (1-3). In the mouse Aatf is ubiquitously expressed early in development; expression is restricted to the liver and central nervous system from embryonic day (E)11.5 onward (4). The AATF protein is localized to the nucleus and the nucleoli (4).
|
| Background |
AATF is an interacting protein for RNA polymerase II. In addition, AATF counteracts Rb repression to facilitate E2F-dependent transactivation during G1-S transition. AATF also functions in the DNA damage response and cell-cycle checkpoint control. AATF is an adaptor that connects transcriptional regulation, cell-cycle progression, checkpoint control, and apoptosis [reviewed in (5)].
AatfGt(pGT1.8geo)3Pgr/Gt(pGT1.8geo)3Pgr; MGI:2176283
Genetic background: either: (involves: 129/Sv * C57BL/6) or (involves: 129/Sv * NMRI)
Homozygous embryos do not develop past the compacted morula stage, and after failing to maintain compaction (4). Mutant embryos show abnormal morphology at E3.5, with most not forming a blastocoel cavity (4). Severely reduced cell proliferation is observed before blastocyst formation (4). Homozygous embryos also exhibit 50% reduction in total cell number resulting in decreased embryo size (4).
|
| References |
1. Lindfors, K., Halttunen, T., Huotari, P., Nupponen, N., Vihinen, M., Visakorpi, T., Maki, M., and Kainulainen, H. (2000) Identification of Novel Transcription Factor-Like Gene from Human Intestinal Cells. Biochem Biophys Res Commun. 276, 660-666. 2. Fanciulli, M., Bruno, T., Di Padova, M., De Angelis, R., Iezzi, S., Iacobini, C., Floridi, A., and Passananti, C. (2000) Identification of a Novel Partner of RNA Polymerase II Subunit 11, Che-1, which Interacts with and Affects the Growth Suppression Function of Rb. FASEB J. 14, 904-912. 4. Thomas, T., Voss, A. K., Petrou, P., and Gruss, P. (2000) The Murine Gene, Traube, is Essential for the Growth of Preimplantation Embryos. Dev Biol. 227, 324-342. |
| Posted On |
2013-04-16 |
| Science Writer |
Anne Murray |
Incidental Mutation