Incidental Mutation 'R3123:Tnpo1'
ID264169
Institutional Source Beutler Lab
Gene Symbol Tnpo1
Ensembl Gene ENSMUSG00000009470
Gene Nametransportin 1
SynonymsKpnb2, D13Ertd688e
MMRRC Submission 040596-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R3123 (G1)
Quality Score118
Status Validated
Chromosome13
Chromosomal Location98839019-98926384 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCACCTCTGCTTCCTC to GCACCTCTGCTTCCTCACCTCTGCTTCCTC at 98867129 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109399] [ENSMUST00000109401] [ENSMUST00000179301]
Predicted Effect probably null
Transcript: ENSMUST00000109399
SMART Domains Protein: ENSMUSP00000105026
Gene: ENSMUSG00000009470

DomainStartEndE-ValueType
IBN_N 33 101 1.53e-6 SMART
low complexity region 350 368 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
Pfam:HEAT_EZ 411 465 4.7e-12 PFAM
Pfam:HEAT 439 469 6.8e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109401
SMART Domains Protein: ENSMUSP00000105028
Gene: ENSMUSG00000009470

DomainStartEndE-ValueType
IBN_N 41 109 1.53e-6 SMART
low complexity region 358 376 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
Pfam:HEAT_EZ 419 473 6.6e-15 PFAM
Pfam:HEAT 447 477 1.3e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179301
SMART Domains Protein: ENSMUSP00000136917
Gene: ENSMUSG00000009470

DomainStartEndE-ValueType
IBN_N 33 101 1.53e-6 SMART
low complexity region 350 368 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
Pfam:HEAT_EZ 411 465 4.2e-12 PFAM
Pfam:HEAT 439 469 6.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224099
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the karyopherin receptor complex which interacts with nuclear localization signals to target nuclear proteins to the nucleus. The karyopherin receptor complex is a heterodimer of an alpha subunit which recognizes the nuclear localization signal and a beta subunit which docks the complex at nucleoporins. Alternate splicing of this gene results in two transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,358,580 I646V possibly damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Csn1s2b T C 5: 87,819,058 probably benign Het
Ctsa T A 2: 164,835,232 probably null Het
Cyp2j8 G A 4: 96,501,213 probably benign Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Dhx9 T C 1: 153,465,706 K599E possibly damaging Het
Duox2 A G 2: 122,281,073 probably benign Het
F2rl3 T C 8: 72,763,212 S356P probably damaging Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Glra3 A G 8: 56,125,209 R434G possibly damaging Het
Gpr75 T A 11: 30,891,709 S205T possibly damaging Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Htt T C 5: 34,804,531 S287P probably benign Het
Ifi27l2b T C 12: 103,451,335 T198A unknown Het
Kdm5d T C Y: 900,558 V201A possibly damaging Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Lonp1 A G 17: 56,626,488 I129T possibly damaging Het
Macc1 T C 12: 119,447,633 F712S probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Nop2 G A 6: 125,132,201 probably benign Het
Olfr1115 A T 2: 87,252,791 T285S possibly damaging Het
Olfr131 G A 17: 38,082,012 probably null Het
Olfr166 A G 16: 19,487,015 Y59C probably damaging Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Pkd1l1 T A 11: 8,973,021 D82V unknown Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Ppwd1 C T 13: 104,213,690 E396K possibly damaging Het
Prr30 A G 14: 101,198,989 S46P probably benign Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ptpn4 A G 1: 119,765,423 probably null Het
Rad18 A T 6: 112,681,346 D199E probably benign Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Rbm27 A G 18: 42,327,165 E764G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Taf15 G A 11: 83,504,328 probably null Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tgfbr2 G A 9: 116,110,069 T230M possibly damaging Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Upf1 A G 8: 70,337,483 probably benign Het
Vmn2r109 C T 17: 20,540,986 C703Y probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Zfp777 A G 6: 48,029,116 probably benign Het
Other mutations in Tnpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Tnpo1 APN 13 98850104 splice site probably benign
IGL02572:Tnpo1 APN 13 98849159 missense probably damaging 1.00
IGL03040:Tnpo1 APN 13 98859955 missense probably damaging 0.99
IGL03237:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03379:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03393:Tnpo1 APN 13 98888473 missense probably damaging 0.99
IGL03405:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03407:Tnpo1 APN 13 98863840 missense probably damaging 0.98
domineight UTSW 13 98867129 frame shift probably null
invert UTSW 13 98855446 missense probably damaging 1.00
R0308:Tnpo1 UTSW 13 98846503 missense probably damaging 0.97
R0465:Tnpo1 UTSW 13 98884634 missense probably damaging 0.97
R0492:Tnpo1 UTSW 13 98855446 missense probably damaging 1.00
R0707:Tnpo1 UTSW 13 98855446 missense probably damaging 1.00
R0732:Tnpo1 UTSW 13 98863812 missense probably damaging 0.99
R1314:Tnpo1 UTSW 13 98860722 missense probably damaging 0.99
R1449:Tnpo1 UTSW 13 98878712 missense probably damaging 0.99
R1468:Tnpo1 UTSW 13 98850157 missense probably benign 0.25
R1468:Tnpo1 UTSW 13 98850157 missense probably benign 0.25
R1488:Tnpo1 UTSW 13 98856907 missense probably damaging 0.98
R1961:Tnpo1 UTSW 13 98852932 missense probably damaging 1.00
R3124:Tnpo1 UTSW 13 98867129 frame shift probably null
R4151:Tnpo1 UTSW 13 98852899 missense probably damaging 1.00
R4272:Tnpo1 UTSW 13 98867129 frame shift probably null
R4274:Tnpo1 UTSW 13 98867129 frame shift probably null
R5154:Tnpo1 UTSW 13 98870305 missense possibly damaging 0.84
R5763:Tnpo1 UTSW 13 98859937 missense possibly damaging 0.54
R5765:Tnpo1 UTSW 13 98859841 missense probably benign 0.08
R5827:Tnpo1 UTSW 13 98856908 missense probably damaging 1.00
R6240:Tnpo1 UTSW 13 98863829 missense probably damaging 1.00
R6279:Tnpo1 UTSW 13 98890708 missense possibly damaging 0.90
R6294:Tnpo1 UTSW 13 98890774 missense probably benign 0.03
R7055:Tnpo1 UTSW 13 98855479 missense possibly damaging 0.85
R7509:Tnpo1 UTSW 13 98870243 missense probably benign 0.00
Z1088:Tnpo1 UTSW 13 98860670 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCATGATGAGCAAAACCTAGTCTC -3'
(R):5'- CCCCAGATGTGTATGTGCAC -3'

Sequencing Primer
(F):5'- GTTTAAATAATTCCTCCACCGGGCAG -3'
(R):5'- TGTATGTGCACAAAGGAGTTCC -3'
Posted On2015-02-05