Incidental Mutation 'R3124:Glra3'
ID264200
Institutional Source Beutler Lab
Gene Symbol Glra3
Ensembl Gene ENSMUSG00000038257
Gene Nameglycine receptor, alpha 3 subunit
Synonyms
MMRRC Submission 040597-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3124 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location55940460-56130070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56125209 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 434 (R434G)
Ref Sequence ENSEMBL: ENSMUSP00000000275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000275
AA Change: R434G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000275
Gene: ENSMUSG00000038257
AA Change: R434G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Neur_chan_LBD 59 269 3.7e-55 PFAM
Pfam:Neur_chan_memb 276 434 1.4e-35 PFAM
PDB:2M6I|E 437 474 1e-12 PDB
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ligand-gated ion channel protein family. The encoded protein is a member of the glycine receptor subfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous null mice are fertile and display decreased inflammatory pain sensitization without any gross abnormalities in the brain or spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16b G A 2: 181,494,526 R407H possibly damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Cadm1 A G 9: 47,799,477 E226G possibly damaging Het
Caskin2 T C 11: 115,804,797 D246G probably damaging Het
Cd80 T A 16: 38,473,893 V46E probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Dach2 T C X: 113,819,967 I417T possibly damaging Het
Drd3 T C 16: 43,822,792 F464L probably damaging Het
Dyrk1a G A 16: 94,668,801 probably benign Het
Fam227b T C 2: 126,124,086 T140A probably benign Het
Fam91a1 A G 15: 58,421,889 I101V probably benign Het
Fem1b T C 9: 62,796,554 I475V probably benign Het
Hsd17b12 C T 2: 94,033,958 R268Q probably benign Het
Iglc3 T C 16: 19,065,595 probably benign Het
Khdrbs2 C A 1: 32,519,777 R408L probably damaging Het
Loxhd1 A G 18: 77,431,078 D1860G probably damaging Het
Mcpt8 A T 14: 56,083,941 I22K probably damaging Het
Myo1h A G 5: 114,328,799 I303V probably benign Het
Nipsnap2 G A 5: 129,748,034 probably null Het
Nop2 G A 6: 125,132,201 probably benign Het
Pet2 A T X: 89,404,721 Y601N probably benign Het
Polr2a A T 11: 69,735,710 S1566T possibly damaging Het
Pthlh A T 6: 147,263,291 V27E probably damaging Het
Ralgps1 T C 2: 33,158,956 T314A possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Skil A G 3: 31,097,338 N3S probably benign Het
Tas2r129 A G 6: 132,951,448 N116S probably damaging Het
Tas2r140 T A 6: 133,055,241 I185L probably benign Het
Tnpo1 GCACCTCTGCTTCCTC GCACCTCTGCTTCCTCACCTCTGCTTCCTC 13: 98,867,129 probably null Het
Togaram1 G T 12: 64,966,344 R123L probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim12a G T 7: 104,300,856 T292K probably benign Het
Trim9 C T 12: 70,248,393 G648R probably damaging Het
Trmt13 T C 3: 116,590,244 I104V probably benign Het
Vav3 G A 3: 109,628,168 probably null Het
Vmn1r87 A G 7: 13,131,566 Y265H probably damaging Het
Zfp574 G T 7: 25,081,601 A683S possibly damaging Het
Other mutations in Glra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Glra3 APN 8 55940977 splice site probably benign
IGL01301:Glra3 APN 8 55940962 missense probably benign 0.00
IGL01772:Glra3 APN 8 56089055 missense probably benign 0.22
IGL02280:Glra3 APN 8 55940971 missense possibly damaging 0.67
IGL02386:Glra3 APN 8 56089028 missense probably benign 0.12
IGL02508:Glra3 APN 8 56085144 missense probably benign 0.10
IGL03094:Glra3 APN 8 56125172 missense probably benign
ANU18:Glra3 UTSW 8 55940962 missense probably benign 0.00
R0532:Glra3 UTSW 8 56125076 missense probably benign
R0708:Glra3 UTSW 8 56125364 utr 3 prime probably benign
R0710:Glra3 UTSW 8 56125364 utr 3 prime probably benign
R0927:Glra3 UTSW 8 56125204 missense possibly damaging 0.65
R1125:Glra3 UTSW 8 56039754 missense possibly damaging 0.69
R1138:Glra3 UTSW 8 56088976 splice site probably null
R1717:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1718:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1848:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1933:Glra3 UTSW 8 55940907 missense probably benign 0.07
R1934:Glra3 UTSW 8 55940907 missense probably benign 0.07
R2042:Glra3 UTSW 8 56062459 missense probably benign 0.36
R2571:Glra3 UTSW 8 56110481 missense probably benign 0.41
R3123:Glra3 UTSW 8 56125209 missense possibly damaging 0.94
R4585:Glra3 UTSW 8 56088993 missense probably damaging 1.00
R4593:Glra3 UTSW 8 55940881 missense probably damaging 1.00
R4981:Glra3 UTSW 8 55991235 missense possibly damaging 0.69
R5277:Glra3 UTSW 8 55991207 missense possibly damaging 0.79
R5356:Glra3 UTSW 8 55940901 missense probably benign 0.00
R6214:Glra3 UTSW 8 55991256 splice site probably null
R6941:Glra3 UTSW 8 55940926 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAAATCCTGTATCGCTCGC -3'
(R):5'- CCCACTCCTTTGTCAGGGAATC -3'

Sequencing Primer
(F):5'- TGTATCGCTCGCCGTTG -3'
(R):5'- CAGGGAATCTTTCTTCTGAATGC -3'
Posted On2015-02-05