Mutagenetix > Incidental Mutation

Incidental Mutation 'R3148:Sorcs2'

264319

Institutional Source

Beutler Lab

Gene Symbol

Sorcs2

Ensembl Gene

ENSMUSG00000029093

Gene Name

sortilin-related VPS10 domain containing receptor 2

Synonyms

VPS10 domain receptor protein

MMRRC Submission

040600-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3148 (G1)

Quality Score

190

Status

Not validated

Chromosome

Chromosomal Location

36174524-36555483 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36193132 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 778 (Q778R)

Ref Sequence

ENSEMBL: ENSMUSP00000041828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037370]

AlphaFold

Q9EPR5

Predicted Effect

probably benign
Transcript: ENSMUST00000037370
AA Change: Q778R

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: Q778R

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	54	64	N/A	INTRINSIC
low complexity region	89	103	N/A	INTRINSIC
low complexity region	106	130	N/A	INTRINSIC
VPS10	170	780	N/A	SMART
PKD	782	872	7.27e-2	SMART
transmembrane domain	1078	1100	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	C	X: 66,964,984 (GRCm39)	D12G	probably benign	Het
Adamts18	C	A	8: 114,465,490 (GRCm39)	V701L	probably damaging	Het
Alg2	A	T	4: 47,472,259 (GRCm39)	V183D	probably damaging	Het
Ank2	T	C	3: 126,726,724 (GRCm39)	I857V	probably benign	Het
Asb15	G	T	6: 24,566,258 (GRCm39)	A404S	probably damaging	Het
Baalc	A	T	15: 38,812,568 (GRCm39)	E106V	possibly damaging	Het
Catsperd	G	T	17: 56,971,039 (GRCm39)	C701F	possibly damaging	Het
Cc2d2a	T	A	5: 43,866,497 (GRCm39)	I769N	probably damaging	Het
Cntnap4	A	G	8: 113,484,071 (GRCm39)	T375A	probably damaging	Het
Col7a1	A	G	9: 108,790,473 (GRCm39)	T974A	unknown	Het
Ehbp1	T	C	11: 22,050,465 (GRCm39)	Y502C	probably damaging	Het
Kcnj11	C	T	7: 45,748,544 (GRCm39)	V260I	probably benign	Het
Klk14	G	A	7: 43,341,501 (GRCm39)	C51Y	probably damaging	Het
Marf1	A	G	16: 13,943,843 (GRCm39)	V1380A	possibly damaging	Het
Or4k36	T	C	2: 111,146,633 (GRCm39)	F270L	possibly damaging	Het
Otog	T	C	7: 45,939,593 (GRCm39)	L2124P	probably damaging	Het
Pam	T	A	1: 97,823,403 (GRCm39)	N256I	possibly damaging	Het
Pcbp1	C	T	6: 86,502,471 (GRCm39)	E143K	probably damaging	Het
Pramel21	A	T	4: 143,344,047 (GRCm39)	D449V	probably benign	Het
Prrx1	T	C	1: 163,085,417 (GRCm39)	D171G	probably benign	Het
Rasal2	A	T	1: 157,071,334 (GRCm39)		probably benign	Het
Serpinb5	T	A	1: 106,809,555 (GRCm39)	H320Q	probably damaging	Het
Snx4	A	C	16: 33,108,094 (GRCm39)	D296A	probably benign	Het
Spata16	T	C	3: 26,932,861 (GRCm39)		probably null	Het
Tcerg1l	G	T	7: 137,861,596 (GRCm39)	Q378K	probably benign	Het
Trpm1	T	C	7: 63,884,760 (GRCm39)	Y814H	probably benign	Het

Other mutations in Sorcs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Sorcs2	APN	5	36,194,745 (GRCm39)	splice site	probably null
IGL01064:Sorcs2	APN	5	36,222,696 (GRCm39)	missense	probably damaging	1.00
IGL01120:Sorcs2	APN	5	36,178,596 (GRCm39)	missense	probably damaging	0.99
IGL01730:Sorcs2	APN	5	36,205,153 (GRCm39)	missense	probably damaging	1.00
IGL02542:Sorcs2	APN	5	36,183,286 (GRCm39)	missense	probably damaging	0.98
IGL02730:Sorcs2	APN	5	36,219,896 (GRCm39)	missense	probably benign	0.11
IGL02965:Sorcs2	APN	5	36,235,301 (GRCm39)	missense	probably benign	0.13
IGL02997:Sorcs2	APN	5	36,225,492 (GRCm39)	missense	probably damaging	1.00
IGL03000:Sorcs2	APN	5	36,222,675 (GRCm39)	unclassified	probably benign
IGL03141:Sorcs2	APN	5	36,222,699 (GRCm39)	missense	probably benign	0.01
IGL03184:Sorcs2	APN	5	36,188,556 (GRCm39)	missense	probably benign	0.01
IGL03412:Sorcs2	APN	5	36,203,848 (GRCm39)	missense	probably damaging	1.00
R0180:Sorcs2	UTSW	5	36,311,189 (GRCm39)	missense	probably damaging	1.00
R0244:Sorcs2	UTSW	5	36,554,897 (GRCm39)	splice site	probably benign
R0345:Sorcs2	UTSW	5	36,185,218 (GRCm39)	missense	probably benign	0.01
R0519:Sorcs2	UTSW	5	36,188,534 (GRCm39)	missense	probably benign	0.08
R0624:Sorcs2	UTSW	5	36,222,777 (GRCm39)	missense	probably damaging	0.97
R0625:Sorcs2	UTSW	5	36,181,916 (GRCm39)	missense	possibly damaging	0.65
R1169:Sorcs2	UTSW	5	36,185,269 (GRCm39)	missense	possibly damaging	0.70
R1721:Sorcs2	UTSW	5	36,184,092 (GRCm39)	missense	probably damaging	0.98
R1809:Sorcs2	UTSW	5	36,386,564 (GRCm39)	splice site	probably benign
R1935:Sorcs2	UTSW	5	36,228,731 (GRCm39)	missense	possibly damaging	0.88
R1936:Sorcs2	UTSW	5	36,228,731 (GRCm39)	missense	possibly damaging	0.88
R2279:Sorcs2	UTSW	5	36,199,430 (GRCm39)	splice site	probably null
R3803:Sorcs2	UTSW	5	36,555,150 (GRCm39)	missense	probably benign	0.36
R3863:Sorcs2	UTSW	5	36,555,007 (GRCm39)	nonsense	probably null
R4092:Sorcs2	UTSW	5	36,183,166 (GRCm39)	missense	possibly damaging	0.92
R4620:Sorcs2	UTSW	5	36,194,838 (GRCm39)	missense	probably benign	0.00
R5079:Sorcs2	UTSW	5	36,200,796 (GRCm39)	missense	probably damaging	1.00
R5301:Sorcs2	UTSW	5	36,196,734 (GRCm39)	missense	probably damaging	1.00
R5470:Sorcs2	UTSW	5	36,188,527 (GRCm39)	missense	probably benign	0.00
R5568:Sorcs2	UTSW	5	36,203,874 (GRCm39)	nonsense	probably null
R5727:Sorcs2	UTSW	5	36,188,630 (GRCm39)	missense	possibly damaging	0.52
R5874:Sorcs2	UTSW	5	36,386,555 (GRCm39)	missense	probably damaging	1.00
R5890:Sorcs2	UTSW	5	36,386,535 (GRCm39)	missense	probably damaging	1.00
R5946:Sorcs2	UTSW	5	36,186,427 (GRCm39)	missense	probably damaging	1.00
R6005:Sorcs2	UTSW	5	36,176,728 (GRCm39)	missense	probably damaging	1.00
R6048:Sorcs2	UTSW	5	36,185,332 (GRCm39)	splice site	probably null
R6290:Sorcs2	UTSW	5	36,219,931 (GRCm39)	missense	probably damaging	1.00
R6292:Sorcs2	UTSW	5	36,219,931 (GRCm39)	missense	probably damaging	1.00
R6617:Sorcs2	UTSW	5	36,235,310 (GRCm39)	missense	probably damaging	1.00
R6681:Sorcs2	UTSW	5	36,555,154 (GRCm39)	missense	probably benign	0.00
R7024:Sorcs2	UTSW	5	36,178,605 (GRCm39)	missense	probably damaging	0.99
R7056:Sorcs2	UTSW	5	36,225,474 (GRCm39)	missense	probably damaging	1.00
R7569:Sorcs2	UTSW	5	36,183,220 (GRCm39)	missense	probably benign	0.01
R7641:Sorcs2	UTSW	5	36,555,296 (GRCm39)	missense	probably damaging	0.99
R7651:Sorcs2	UTSW	5	36,185,322 (GRCm39)	missense	probably damaging	1.00
R7674:Sorcs2	UTSW	5	36,555,296 (GRCm39)	missense	probably damaging	0.99
R7722:Sorcs2	UTSW	5	36,200,871 (GRCm39)	missense	probably damaging	1.00
R7748:Sorcs2	UTSW	5	36,386,519 (GRCm39)	missense	possibly damaging	0.56
R7764:Sorcs2	UTSW	5	36,181,416 (GRCm39)	missense	possibly damaging	0.48
R7813:Sorcs2	UTSW	5	36,181,958 (GRCm39)	missense	probably damaging	1.00
R8142:Sorcs2	UTSW	5	36,219,958 (GRCm39)	missense	possibly damaging	0.67
R8246:Sorcs2	UTSW	5	36,219,932 (GRCm39)	missense	probably damaging	1.00
R8254:Sorcs2	UTSW	5	36,195,550 (GRCm39)	missense	probably benign	0.00
R8349:Sorcs2	UTSW	5	36,386,519 (GRCm39)	missense	possibly damaging	0.56
R8350:Sorcs2	UTSW	5	36,311,207 (GRCm39)	missense	probably damaging	0.96
R8354:Sorcs2	UTSW	5	36,222,753 (GRCm39)	missense	probably benign	0.01
R8449:Sorcs2	UTSW	5	36,386,519 (GRCm39)	missense	possibly damaging	0.56
R8679:Sorcs2	UTSW	5	36,196,657 (GRCm39)	missense	probably benign	0.09
R8771:Sorcs2	UTSW	5	36,188,624 (GRCm39)	missense	probably damaging	1.00
R8935:Sorcs2	UTSW	5	36,193,202 (GRCm39)	missense	possibly damaging	0.79
R8964:Sorcs2	UTSW	5	36,386,511 (GRCm39)	missense	possibly damaging	0.85
R9164:Sorcs2	UTSW	5	36,235,312 (GRCm39)	missense	possibly damaging	0.94
R9221:Sorcs2	UTSW	5	36,181,910 (GRCm39)	critical splice donor site	probably null
R9290:Sorcs2	UTSW	5	36,183,225 (GRCm39)	missense	probably damaging	0.96
R9358:Sorcs2	UTSW	5	36,200,814 (GRCm39)	missense	probably damaging	1.00
R9492:Sorcs2	UTSW	5	36,186,484 (GRCm39)	missense	probably benign	0.08
R9493:Sorcs2	UTSW	5	36,199,529 (GRCm39)	missense	possibly damaging	0.61
R9640:Sorcs2	UTSW	5	36,222,765 (GRCm39)	nonsense	probably null
RF063:Sorcs2	UTSW	5	36,311,155 (GRCm39)	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTCAAACTGTTCAGAGCCTC -3'
(R):5'- GTGCTTCAGCTCTCCAAAGC -3'

Sequencing Primer
(F):5'- TTCAGAGCCTCAACCTTGGGTG -3'
(R):5'- TGCTCTCAGATATAAGTGGACAG -3'

Posted On

2015-02-05