Incidental Mutation 'R3051:Rbfox3'
ID264962
Institutional Source Beutler Lab
Gene Symbol Rbfox3
Ensembl Gene ENSMUSG00000025576
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 3
SynonymsD11Bwg0517e, NeuN, Neuna60, Hrnbp3
MMRRC Submission 040560-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R3051 (G1)
Quality Score191
Status Validated
Chromosome11
Chromosomal Location118489762-118911597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118502888 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 37 (A37D)
Ref Sequence ENSEMBL: ENSMUSP00000118332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017576] [ENSMUST00000069343] [ENSMUST00000103023] [ENSMUST00000106278] [ENSMUST00000117731] [ENSMUST00000120061] [ENSMUST00000136551] [ENSMUST00000154746]
Predicted Effect probably damaging
Transcript: ENSMUST00000017576
AA Change: A154D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017576
Gene: ENSMUSG00000025576
AA Change: A154D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 208 269 1e-22 PFAM
Pfam:Fox-1_C 279 345 3.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069343
SMART Domains Protein: ENSMUSP00000069598
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 165 8.3e-2 SMART
Pfam:Fox-1_C 176 229 4.1e-15 PFAM
Pfam:Fox-1_C 226 314 4.8e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103023
AA Change: A154D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099312
Gene: ENSMUSG00000025576
AA Change: A154D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106278
AA Change: A154D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101885
Gene: ENSMUSG00000025576
AA Change: A154D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117731
AA Change: A154D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113636
Gene: ENSMUSG00000025576
AA Change: A154D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 260 3.5e-15 PFAM
Pfam:Fox-1_C 257 345 4.3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120061
AA Change: A154D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113987
Gene: ENSMUSG00000025576
AA Change: A154D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 6.1e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136551
AA Change: A154D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119255
Gene: ENSMUSG00000025576
AA Change: A154D

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 169 6.65e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154746
AA Change: A37D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118332
Gene: ENSMUSG00000025576
AA Change: A37D

DomainStartEndE-ValueType
RRM 1 54 8.6e-5 SMART
Pfam:Fox-1_C 90 142 5.5e-16 PFAM
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced brain weight, increased susceptibility kainic acid-induced seizures, decreased anxiety-related behaviors, and deficits in synaptic transmission and plasticity in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik G A X: 89,754,103 V514I probably damaging Het
Acsl1 G A 8: 46,521,337 V330I probably benign Het
Akap6 T C 12: 52,887,033 L436P probably damaging Het
Axin1 A G 17: 26,190,125 T700A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Ccdc178 T A 18: 22,135,131 M100L probably benign Het
Ceacam20 T A 7: 19,976,185 V378E probably benign Het
Cwf19l2 G A 9: 3,410,006 R45H probably benign Het
Cyp2a5 A G 7: 26,842,985 I471V possibly damaging Het
Ddr2 T C 1: 169,988,455 K561R probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Ltf A G 9: 111,024,522 D280G probably benign Het
Nlrc5 A G 8: 94,476,715 E481G probably benign Het
Olfr390 A G 11: 73,787,234 T99A probably benign Het
Pald1 G A 10: 61,346,763 Q412* probably null Het
Ptprd A G 4: 76,100,630 Y649H probably damaging Het
R3hcc1l T G 19: 42,562,625 Y20* probably null Het
Rpa2 A G 4: 132,775,126 probably null Het
Ryr1 A T 7: 29,053,090 V3598E probably damaging Het
Slc6a7 G A 18: 61,009,517 T41M probably damaging Het
Tacc2 G A 7: 130,625,496 E1323K possibly damaging Het
Ten1 T C 11: 116,205,730 F70S possibly damaging Het
Terf2 A C 8: 107,079,384 L312R possibly damaging Het
Tktl1 A G X: 74,177,404 T39A probably benign Het
Tmem51 A T 4: 142,032,024 Y138N probably damaging Het
Trp53bp2 T C 1: 182,453,782 F983L probably damaging Het
Trpm1 G A 7: 64,269,101 E730K probably damaging Het
Ubxn2a T A 12: 4,891,322 K95* probably null Het
Xpo6 T C 7: 126,104,721 N1086D probably damaging Het
Zfp345 T C 2: 150,474,852 N12D probably benign Het
Other mutations in Rbfox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Rbfox3 APN 11 118505613 splice site probably benign
IGL01622:Rbfox3 APN 11 118505614 splice site probably benign
IGL01623:Rbfox3 APN 11 118505614 splice site probably benign
IGL01716:Rbfox3 APN 11 118513289 missense possibly damaging 0.89
IGL01772:Rbfox3 APN 11 118496971 missense probably damaging 0.98
IGL03162:Rbfox3 APN 11 118496431 missense probably benign 0.06
PIT4431001:Rbfox3 UTSW 11 118495221 missense probably damaging 1.00
R0267:Rbfox3 UTSW 11 118495240 missense probably benign 0.00
R1659:Rbfox3 UTSW 11 118494155 missense probably damaging 0.99
R1681:Rbfox3 UTSW 11 118505669 missense probably damaging 1.00
R1698:Rbfox3 UTSW 11 118495221 missense probably damaging 1.00
R1731:Rbfox3 UTSW 11 118496936 critical splice donor site probably null
R2134:Rbfox3 UTSW 11 118497016 missense probably damaging 1.00
R2249:Rbfox3 UTSW 11 118503738 missense probably damaging 0.99
R3404:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R3405:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R3406:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R5276:Rbfox3 UTSW 11 118496352 missense probably damaging 1.00
R7243:Rbfox3 UTSW 11 118513274 missense probably damaging 1.00
X0013:Rbfox3 UTSW 11 118497041 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ATGAAGGTGTGAGGCTGTCC -3'
(R):5'- CCAGTACAATCTCCTAGTGCTGG -3'

Sequencing Primer
(F):5'- AGGCTGTCCTCAGGGGC -3'
(R):5'- ACAGACTTCTGACACTGGGG -3'
Posted On2015-02-05