Incidental Mutation 'R3023:Plekhm3'
ID265739
Institutional Source Beutler Lab
Gene Symbol Plekhm3
Ensembl Gene ENSMUSG00000051344
Gene Namepleckstrin homology domain containing, family M, member 3
Synonyms9430067K14Rik, A230102O09Rik, Plekhm1l
MMRRC Submission 040539-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R3023 (G1)
Quality Score124
Status Not validated
Chromosome1
Chromosomal Location64785983-64956824 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CCTGCTGCTGCTGCTGCTGCTGCTGC to CCTGCTGCTGCTGCTGCTGCTGC at 64937781 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097713] [ENSMUST00000123225] [ENSMUST00000139649]
Predicted Effect probably benign
Transcript: ENSMUST00000097713
SMART Domains Protein: ENSMUSP00000095320
Gene: ENSMUSG00000051344

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123225
Predicted Effect probably benign
Transcript: ENSMUST00000139649
SMART Domains Protein: ENSMUSP00000138002
Gene: ENSMUSG00000051344

DomainStartEndE-ValueType
low complexity region 184 195 N/A INTRINSIC
PH 213 311 4.86e-3 SMART
PH 362 458 7.88e-12 SMART
low complexity region 489 503 N/A INTRINSIC
DUF4206 529 732 2.73e-114 SMART
C1 670 722 3.9e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181350
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,669,572 E1060D probably benign Het
Abca15 A T 7: 120,382,779 I1106F probably benign Het
Arl5a A G 2: 52,416,197 V41A probably benign Het
Atp8b5 A G 4: 43,311,957 D190G possibly damaging Het
Cc2d2a T A 5: 43,685,251 probably null Het
Ckap2 T C 8: 22,175,861 N390S possibly damaging Het
Dtx3l A G 16: 35,932,436 I600T probably benign Het
Epb41l1 A C 2: 156,514,209 E555A probably damaging Het
Fxr1 G A 3: 34,064,224 R503H probably damaging Het
Igf1r A G 7: 68,183,399 N436D probably benign Het
Kif26b G A 1: 178,864,868 C11Y probably damaging Het
Olfr1251 A G 2: 89,667,646 I80T possibly damaging Het
Osbpl6 A T 2: 76,586,733 I703F probably damaging Het
Plcd4 A G 1: 74,548,192 Y37C probably damaging Het
Pwwp2b G A 7: 139,256,194 R517H probably damaging Het
Rp1 G A 1: 4,352,675 R61W probably damaging Het
Sdk1 C G 5: 142,046,236 T1022S probably benign Het
Slc12a7 T A 13: 73,800,422 S669T probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Tlr2 C T 3: 83,837,871 V302I probably benign Het
Trav7-6 A G 14: 53,717,244 K77R probably benign Het
Vmn2r18 T C 5: 151,561,683 N782S probably benign Het
Vmn2r78 G T 7: 86,954,966 S784I probably damaging Het
Other mutations in Plekhm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Plekhm3 APN 1 64921832 missense probably damaging 1.00
IGL01732:Plekhm3 APN 1 64922248 missense probably benign 0.44
IGL02422:Plekhm3 APN 1 64921866 nonsense probably null
IGL02724:Plekhm3 APN 1 64795117 missense probably damaging 0.97
IGL03226:Plekhm3 APN 1 64921800 missense possibly damaging 0.58
IGL03250:Plekhm3 APN 1 64938047 missense possibly damaging 0.65
R0124:Plekhm3 UTSW 1 64921751 missense probably damaging 0.99
R1336:Plekhm3 UTSW 1 64937781 small deletion probably benign
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1467:Plekhm3 UTSW 1 64892882 missense probably damaging 1.00
R1560:Plekhm3 UTSW 1 64937817 missense probably benign 0.03
R1901:Plekhm3 UTSW 1 64937781 small deletion probably benign
R2328:Plekhm3 UTSW 1 64937781 small deletion probably benign
R2432:Plekhm3 UTSW 1 64937856 missense probably damaging 1.00
R2568:Plekhm3 UTSW 1 64937781 small deletion probably benign
R4496:Plekhm3 UTSW 1 64861236 missense probably damaging 1.00
R4529:Plekhm3 UTSW 1 64937825 missense probably benign 0.14
R4682:Plekhm3 UTSW 1 64937927 missense possibly damaging 0.94
R4969:Plekhm3 UTSW 1 64937919 missense probably damaging 1.00
R5347:Plekhm3 UTSW 1 64819990 missense probably damaging 1.00
R5553:Plekhm3 UTSW 1 64921886 missense possibly damaging 0.89
R5583:Plekhm3 UTSW 1 64937986 nonsense probably null
R5953:Plekhm3 UTSW 1 64937895 missense probably damaging 0.98
R6319:Plekhm3 UTSW 1 64921934 missense probably benign 0.20
R6970:Plekhm3 UTSW 1 64892753 missense possibly damaging 0.80
R7014:Plekhm3 UTSW 1 64883270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATATGTGGGTACTGGAGAGTC -3'
(R):5'- GGACAGCCCCAGATAATCTTTCC -3'

Sequencing Primer
(F):5'- TGGGTACTGGAGAGTCAGCAG -3'
(R):5'- CAGATAATCTTTCCTGGATGGCAC -3'
Posted On2015-02-05