Incidental Mutation 'R3724:6430548M08Rik'
ID270684
Institutional Source Beutler Lab
Gene Symbol 6430548M08Rik
Ensembl Gene ENSMUSG00000031824
Gene NameRIKEN cDNA 6430548M08 gene
Synonyms
MMRRC Submission 040715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R3724 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location120114152-120165306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120149360 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 133 (R133L)
Ref Sequence ENSEMBL: ENSMUSP00000114976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034281] [ENSMUST00000108948] [ENSMUST00000108950] [ENSMUST00000108951] [ENSMUST00000127664] [ENSMUST00000132229] [ENSMUST00000153725]
Predicted Effect probably damaging
Transcript: ENSMUST00000034281
AA Change: R133L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034281
Gene: ENSMUSG00000031824
AA Change: R133L

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108948
AA Change: R133L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104576
Gene: ENSMUSG00000031824
AA Change: R133L

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108950
AA Change: R133L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104578
Gene: ENSMUSG00000031824
AA Change: R133L

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108951
AA Change: R133L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104579
Gene: ENSMUSG00000031824
AA Change: R133L

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132229
SMART Domains Protein: ENSMUSP00000117269
Gene: ENSMUSG00000031824

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153725
AA Change: R133L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114976
Gene: ENSMUSG00000031824
AA Change: R133L

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212474
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G A 8: 71,461,492 A164V probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Atl1 A G 12: 69,959,380 T487A probably damaging Het
C2cd6 C T 1: 59,066,235 probably benign Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Ccna1 T C 3: 55,050,932 E110G probably damaging Het
Ccne2 T C 4: 11,203,039 C386R probably benign Het
Cfap53 A G 18: 74,359,569 I455V probably benign Het
Ctdp1 C T 18: 80,459,267 V143I probably benign Het
Cyp11a1 A T 9: 58,019,322 M47L probably benign Het
Dnah5 T C 15: 28,270,420 L956P probably benign Het
Enkd1 A T 8: 105,703,925 V326E possibly damaging Het
Epha4 A G 1: 77,426,543 probably benign Het
Etv5 T C 16: 22,435,912 D66G probably damaging Het
Evi5l A G 8: 4,178,080 probably benign Het
Foxf2 A G 13: 31,630,530 K409R probably damaging Het
Frem3 A G 8: 80,615,271 T1398A probably benign Het
Galm A G 17: 80,183,280 T289A probably benign Het
Gtdc1 T C 2: 44,756,307 E44G probably damaging Het
Hmcn1 T A 1: 150,689,518 Y2286F possibly damaging Het
Iars A G 13: 49,687,384 probably null Het
Ifna5 A G 4: 88,835,934 E137G probably damaging Het
Itih4 G A 14: 30,892,584 E468K possibly damaging Het
Kat6a A T 8: 22,862,788 H196L probably damaging Het
Kctd16 A G 18: 40,258,859 T167A possibly damaging Het
Klhl29 C T 12: 5,090,603 V680I probably damaging Het
March7 T C 2: 60,229,745 I72T probably benign Het
Mbd6 C T 10: 127,283,891 probably benign Het
Mefv A G 16: 3,708,194 probably null Het
Mindy3 T A 2: 12,355,354 M6L probably damaging Het
Mrpl9 T A 3: 94,447,766 probably null Het
Nlrp4e A T 7: 23,321,377 T430S probably benign Het
Olfr1187-ps1 T G 2: 88,540,286 noncoding transcript Het
Pcdh15 A T 10: 74,645,848 T342S probably benign Het
Prkce A T 17: 86,168,623 K11* probably null Het
Pros1 T C 16: 62,900,329 I117T possibly damaging Het
Prpf38b T C 3: 108,904,340 probably benign Het
Sh3rf1 T C 8: 61,372,722 S584P probably benign Het
Slit2 T C 5: 48,256,883 probably null Het
Srsf4 C T 4: 131,900,102 probably benign Het
Stambp C T 6: 83,557,466 E280K probably damaging Het
Tenm3 A G 8: 48,277,746 I1329T probably damaging Het
Tex2 G A 11: 106,529,330 T869I unknown Het
Tlk2 A G 11: 105,247,564 T281A probably benign Het
Tpm1 G A 9: 67,031,945 probably benign Het
Trim3 A G 7: 105,611,189 F702L probably damaging Het
Uba6 T C 5: 86,135,047 D559G probably damaging Het
Vmn2r20 T A 6: 123,385,747 T693S probably benign Het
Zfand2b A G 1: 75,169,855 K125E possibly damaging Het
Zfp422 C T 6: 116,626,379 A220T probably benign Het
Zfp747 A T 7: 127,374,590 V136D probably benign Het
Other mutations in 6430548M08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02861:6430548M08Rik APN 8 120150124 missense probably damaging 1.00
R0137:6430548M08Rik UTSW 8 120151376 missense possibly damaging 0.87
R1019:6430548M08Rik UTSW 8 120145470 missense probably damaging 0.98
R1140:6430548M08Rik UTSW 8 120150135 missense probably damaging 1.00
R2026:6430548M08Rik UTSW 8 120153466 missense probably benign 0.00
R2209:6430548M08Rik UTSW 8 120157488 missense possibly damaging 0.73
R2508:6430548M08Rik UTSW 8 120145393 missense probably benign 0.03
R2884:6430548M08Rik UTSW 8 120145511 missense possibly damaging 0.94
R3944:6430548M08Rik UTSW 8 120152502 missense probably damaging 1.00
R4584:6430548M08Rik UTSW 8 120160017 missense probably damaging 1.00
R4668:6430548M08Rik UTSW 8 120160414 critical splice donor site probably null
R5883:6430548M08Rik UTSW 8 120145641 missense probably damaging 0.98
R6621:6430548M08Rik UTSW 8 120145423 missense possibly damaging 0.60
R6919:6430548M08Rik UTSW 8 120145482 missense probably damaging 1.00
R7023:6430548M08Rik UTSW 8 120145357 missense probably damaging 1.00
R7035:6430548M08Rik UTSW 8 120152486 missense probably damaging 1.00
R7218:6430548M08Rik UTSW 8 120145583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGCTCAAGCCATATCTGG -3'
(R):5'- GTCAGGGGAAGGTCTTTATATCC -3'

Sequencing Primer
(F):5'- CCATATCTGGACCTTGAAGTCAGG -3'
(R):5'- GGAAGGTCTTTATATCCTTCCCCAG -3'
Posted On2015-03-18