Incidental Mutation 'R1019:6430548M08Rik'
ID96760
Institutional Source Beutler Lab
Gene Symbol 6430548M08Rik
Ensembl Gene ENSMUSG00000031824
Gene NameRIKEN cDNA 6430548M08 gene
Synonyms
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location120114152-120165306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 120145470 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 46 (E46Q)
Ref Sequence ENSEMBL: ENSMUSP00000117269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034281] [ENSMUST00000108948] [ENSMUST00000108950] [ENSMUST00000108951] [ENSMUST00000127664] [ENSMUST00000132229] [ENSMUST00000153725]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034281
AA Change: E46Q

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034281
Gene: ENSMUSG00000031824
AA Change: E46Q

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108948
AA Change: E46Q

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104576
Gene: ENSMUSG00000031824
AA Change: E46Q

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108950
AA Change: E46Q

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104578
Gene: ENSMUSG00000031824
AA Change: E46Q

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108951
AA Change: E46Q

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104579
Gene: ENSMUSG00000031824
AA Change: E46Q

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132229
AA Change: E46Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117269
Gene: ENSMUSG00000031824
AA Change: E46Q

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153725
AA Change: E46Q

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114976
Gene: ENSMUSG00000031824
AA Change: E46Q

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212474
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Slc6a18 T A 13: 73,677,879 R17S probably damaging Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in 6430548M08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02861:6430548M08Rik APN 8 120150124 missense probably damaging 1.00
R0137:6430548M08Rik UTSW 8 120151376 missense possibly damaging 0.87
R1140:6430548M08Rik UTSW 8 120150135 missense probably damaging 1.00
R2026:6430548M08Rik UTSW 8 120153466 missense probably benign 0.00
R2209:6430548M08Rik UTSW 8 120157488 missense possibly damaging 0.73
R2508:6430548M08Rik UTSW 8 120145393 missense probably benign 0.03
R2884:6430548M08Rik UTSW 8 120145511 missense possibly damaging 0.94
R3724:6430548M08Rik UTSW 8 120149360 missense probably damaging 1.00
R3944:6430548M08Rik UTSW 8 120152502 missense probably damaging 1.00
R4584:6430548M08Rik UTSW 8 120160017 missense probably damaging 1.00
R4668:6430548M08Rik UTSW 8 120160414 critical splice donor site probably null
R5883:6430548M08Rik UTSW 8 120145641 missense probably damaging 0.98
R6621:6430548M08Rik UTSW 8 120145423 missense possibly damaging 0.60
R6919:6430548M08Rik UTSW 8 120145482 missense probably damaging 1.00
R7023:6430548M08Rik UTSW 8 120145357 missense probably damaging 1.00
R7035:6430548M08Rik UTSW 8 120152486 missense probably damaging 1.00
R7218:6430548M08Rik UTSW 8 120145583 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCATTGCAGACGCCACAGG -3'
(R):5'- CGCATAAACTCTCGAAGTGCCAGG -3'

Sequencing Primer
(F):5'- TCTGAGCTGCAAGAGACTTC -3'
(R):5'- TCGAAGTGCCAGGGTCTC -3'
Posted On2014-01-05