Incidental Mutation 'R2884:6430548M08Rik'
ID260968
Institutional Source Beutler Lab
Gene Symbol 6430548M08Rik
Ensembl Gene ENSMUSG00000031824
Gene NameRIKEN cDNA 6430548M08 gene
Synonyms
MMRRC Submission 040472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2884 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location120114152-120165306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120145511 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 59 (E59D)
Ref Sequence ENSEMBL: ENSMUSP00000117269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034281] [ENSMUST00000108948] [ENSMUST00000108950] [ENSMUST00000108951] [ENSMUST00000127664] [ENSMUST00000132229] [ENSMUST00000153725]
Predicted Effect probably benign
Transcript: ENSMUST00000034281
AA Change: E59D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034281
Gene: ENSMUSG00000031824
AA Change: E59D

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108948
AA Change: E59D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000104576
Gene: ENSMUSG00000031824
AA Change: E59D

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108950
AA Change: E59D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104578
Gene: ENSMUSG00000031824
AA Change: E59D

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108951
AA Change: E59D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104579
Gene: ENSMUSG00000031824
AA Change: E59D

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000132229
AA Change: E59D

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117269
Gene: ENSMUSG00000031824
AA Change: E59D

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153725
AA Change: E59D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000114976
Gene: ENSMUSG00000031824
AA Change: E59D

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212474
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap27 T C 11: 103,360,843 probably null Het
BC061237 A G 14: 44,501,170 R9G possibly damaging Het
BC067074 A T 13: 113,320,682 Q1087H probably damaging Het
BC067074 G T 13: 113,369,191 A2285S probably benign Het
Brsk1 A G 7: 4,691,123 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dnajb5 A T 4: 42,957,355 D284V probably damaging Het
Dnmt3a A G 12: 3,896,132 D329G probably damaging Het
Ecd C T 14: 20,320,773 G626D probably damaging Het
Exoc3l4 A G 12: 111,428,522 D551G possibly damaging Het
Fam227b A T 2: 126,100,926 I317N probably benign Het
Fam3c G A 6: 22,329,582 R49C probably damaging Het
Fcrl5 A G 3: 87,457,391 Y566C probably damaging Het
Fras1 A G 5: 96,700,268 N1779S probably benign Het
Gm19965 T A 1: 116,821,583 N331K probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
H2-DMa A G 17: 34,137,147 N41S probably damaging Het
Habp4 A T 13: 64,182,266 R328S probably benign Het
Hexb C T 13: 97,183,700 G272D probably damaging Het
Hist1h2ae A G 13: 23,570,873 I79T probably damaging Het
Lilrb4a A T 10: 51,491,613 N84Y probably benign Het
Mtnr1a A G 8: 45,087,268 T89A probably benign Het
Myh13 T A 11: 67,337,643 N336K probably benign Het
Naca T C 10: 128,041,678 probably benign Het
Naif1 C T 2: 32,454,875 P197L probably benign Het
Nprl3 A G 11: 32,248,163 L179P probably damaging Het
Nup93 A G 8: 94,303,638 Y375C probably damaging Het
Olfr547 A G 7: 102,535,232 I162V probably benign Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plekhs1 G A 19: 56,470,826 G39R probably benign Het
Ppp4r3a T C 12: 101,068,677 E53G probably damaging Het
Prss48 A T 3: 85,997,255 M212K probably benign Het
Pth A T 7: 113,386,028 L46Q probably damaging Het
Rin2 A T 2: 145,860,991 T536S probably benign Het
Setx T G 2: 29,148,625 C1707W probably damaging Het
Stau2 A T 1: 16,231,066 F519Y possibly damaging Het
Syne2 T G 12: 75,963,759 V2481G probably benign Het
Tpte C T 8: 22,335,423 Q331* probably null Het
Ttn G T 2: 76,900,252 probably benign Het
Utrn A T 10: 12,739,361 probably null Het
Vmn2r82 A G 10: 79,396,248 I694V probably benign Het
Vmn2r88 G A 14: 51,413,934 C235Y probably damaging Het
Xrn2 T A 2: 147,047,656 V653E probably damaging Het
Znrf3 A T 11: 5,289,693 D58E probably damaging Het
Other mutations in 6430548M08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02861:6430548M08Rik APN 8 120150124 missense probably damaging 1.00
R0137:6430548M08Rik UTSW 8 120151376 missense possibly damaging 0.87
R1019:6430548M08Rik UTSW 8 120145470 missense probably damaging 0.98
R1140:6430548M08Rik UTSW 8 120150135 missense probably damaging 1.00
R2026:6430548M08Rik UTSW 8 120153466 missense probably benign 0.00
R2209:6430548M08Rik UTSW 8 120157488 missense possibly damaging 0.73
R2508:6430548M08Rik UTSW 8 120145393 missense probably benign 0.03
R3724:6430548M08Rik UTSW 8 120149360 missense probably damaging 1.00
R3944:6430548M08Rik UTSW 8 120152502 missense probably damaging 1.00
R4584:6430548M08Rik UTSW 8 120160017 missense probably damaging 1.00
R4668:6430548M08Rik UTSW 8 120160414 critical splice donor site probably null
R5883:6430548M08Rik UTSW 8 120145641 missense probably damaging 0.98
R6621:6430548M08Rik UTSW 8 120145423 missense possibly damaging 0.60
R6919:6430548M08Rik UTSW 8 120145482 missense probably damaging 1.00
R7023:6430548M08Rik UTSW 8 120145357 missense probably damaging 1.00
R7035:6430548M08Rik UTSW 8 120152486 missense probably damaging 1.00
R7218:6430548M08Rik UTSW 8 120145583 missense probably damaging 1.00
R7343:6430548M08Rik UTSW 8 120145588 missense probably benign
R7424:6430548M08Rik UTSW 8 120145545 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGAAGCTGCTCCTCAG -3'
(R):5'- TACCTTCCATTCACAGAGTCTG -3'

Sequencing Primer
(F):5'- ATCCTGTTTGGCAGCCCAG -3'
(R):5'- CAGAGTCTGTTCATCCCACAG -3'
Posted On2015-01-23