Incidental Mutation 'R3780:Stpg3'
ID271993
Institutional Source Beutler Lab
Gene Symbol Stpg3
Ensembl Gene ENSMUSG00000036770
Gene Namesperm tail PG rich repeat containing 3
Synonyms4933433C11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R3780 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25212207-25214637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25213863 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 154 (M154L)
Ref Sequence ENSEMBL: ENSMUSP00000037603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028346] [ENSMUST00000043774] [ENSMUST00000059849] [ENSMUST00000114363]
Predicted Effect probably benign
Transcript: ENSMUST00000028346
SMART Domains Protein: ENSMUSP00000028346
Gene: ENSMUSG00000026969

DomainStartEndE-ValueType
Pfam:DUF2475 13 71 8.1e-16 PFAM
low complexity region 130 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043774
AA Change: M154L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000037603
Gene: ENSMUSG00000036770
AA Change: M154L

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 103 145 9.5e-4 PFAM
Pfam:SHIPPO-rpt 226 255 1.4e-3 PFAM
Pfam:SHIPPO-rpt 265 291 1.4e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059849
SMART Domains Protein: ENSMUSP00000057731
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 107 578 3.5e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114363
AA Change: M99L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110003
Gene: ENSMUSG00000036770
AA Change: M99L

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 48 79 2.8e-4 PFAM
Pfam:SHIPPO-rpt 110 136 1.2e-1 PFAM
Pfam:SHIPPO-rpt 152 200 3.5e-1 PFAM
Pfam:SHIPPO-rpt 210 248 1.9e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138199
Predicted Effect probably benign
Transcript: ENSMUST00000140934
SMART Domains Protein: ENSMUSP00000115698
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 40 204 9.7e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205741
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,560,838 noncoding transcript Het
Adam21 C T 12: 81,559,273 V572I probably damaging Het
Arhgap32 T A 9: 32,152,019 probably null Het
Carmil1 A T 13: 24,137,169 I281N probably damaging Het
Cdh12 T A 15: 21,585,977 probably null Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cntrob A G 11: 69,302,882 L814P probably damaging Het
Csmd1 T C 8: 16,201,986 N952S probably damaging Het
Cspg4 A G 9: 56,888,233 Y1084C probably damaging Het
Dlg5 A G 14: 24,190,310 probably benign Het
Glis2 T C 16: 4,613,896 probably benign Het
Hif3a T C 7: 17,054,713 E111G probably damaging Het
Kctd4 A G 14: 75,962,811 D74G probably benign Het
Kif21b A T 1: 136,156,226 K737M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama2 A T 10: 27,459,339 N113K probably damaging Het
Ltv1 A G 10: 13,179,200 S409P probably benign Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Myh6 A G 14: 54,963,958 F95L probably benign Het
Ndufa4l2 A G 10: 127,515,420 I27V probably benign Het
Npepl1 T G 2: 174,120,654 L371R probably damaging Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Ocrl G A X: 47,938,303 V416I probably benign Het
Olfr123 T G 17: 37,796,004 C187G probably damaging Het
Padi2 C T 4: 140,917,737 T94I probably benign Het
Pcca G A 14: 122,684,885 E353K probably damaging Het
Pcdhgb2 T A 18: 37,691,757 N600K probably damaging Het
Pex5l A G 3: 32,950,844 L593P probably damaging Het
Rbp2 G A 9: 98,498,826 D62N probably benign Het
Rock1 G T 18: 10,067,575 N1319K probably benign Het
Ror1 A C 4: 100,412,117 D384A probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sacm1l A T 9: 123,552,790 E152D probably benign Het
Seh1l T C 18: 67,775,017 V3A probably benign Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Serpini1 T G 3: 75,614,635 N144K probably damaging Het
Slc22a23 G A 13: 34,344,340 T153I probably benign Het
Slfn8 A G 11: 83,017,454 S88P probably benign Het
Vmn2r115 G A 17: 23,345,172 C106Y probably damaging Het
Washc3 C T 10: 88,219,260 T112M probably benign Het
Zfp280d C T 9: 72,322,524 T346M probably damaging Het
Other mutations in Stpg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Stpg3 APN 2 25213179 unclassified probably benign
IGL01450:Stpg3 APN 2 25214610 unclassified probably benign
R1413:Stpg3 UTSW 2 25213850 missense probably damaging 1.00
R1612:Stpg3 UTSW 2 25213854 missense probably benign 0.00
R3781:Stpg3 UTSW 2 25213863 missense probably benign 0.00
R4694:Stpg3 UTSW 2 25213297 missense probably damaging 0.96
R5029:Stpg3 UTSW 2 25214564 missense probably damaging 0.97
R5406:Stpg3 UTSW 2 25213568 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGCCTGATCCATGCTTTTG -3'
(R):5'- ATACACCATCGGTCGCAAGTAC -3'

Sequencing Primer
(F):5'- GGTTCTCCCTCTACGCCAAAC -3'
(R):5'- AAGTACCCGGTTCGAGGTG -3'
Posted On2015-03-25