Incidental Mutation 'R3850:Plod2'
ID275885
Institutional Source Beutler Lab
Gene Symbol Plod2
Ensembl Gene ENSMUSG00000032374
Gene Nameprocollagen lysine, 2-oxoglutarate 5-dioxygenase 2
SynonymsD530025C14Rik, Plod-2, LH2, lysyl hydroxylase 2
MMRRC Submission 040898-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R3850 (G1)
Quality Score148
Status Validated
Chromosome9
Chromosomal Location92542223-92608428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92542545 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 29 (E29G)
Ref Sequence ENSEMBL: ENSMUSP00000068611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070522] [ENSMUST00000160359]
Predicted Effect probably benign
Transcript: ENSMUST00000070522
AA Change: E29G

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068611
Gene: ENSMUSG00000032374
AA Change: E29G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 563 736 6.38e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160359
AA Change: E29G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125373
Gene: ENSMUSG00000032374
AA Change: E29G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 584 757 6.38e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191720
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066B19Rik G A 18: 35,728,714 V84I probably benign Het
Abca1 C T 4: 53,061,481 probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Antxrl C A 14: 34,067,381 H309Q probably benign Het
Ap1g2 T C 14: 55,104,906 M165V probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cdh17 A G 4: 11,785,201 D331G probably damaging Het
Csmd1 C G 8: 16,079,922 V1729L probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Cwf19l1 T C 19: 44,131,498 Y68C probably benign Het
Dst C T 1: 34,189,274 Q1658* probably null Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Hydin T C 8: 110,563,929 I3340T probably damaging Het
Igfbpl1 C T 4: 45,826,426 R123H probably benign Het
Mov10l1 A T 15: 89,005,695 probably null Het
Mrc2 T C 11: 105,292,903 probably null Het
Muc5b G A 7: 141,862,638 C3107Y possibly damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nfasc T C 1: 132,631,733 T214A probably damaging Het
Olfr1107 T A 2: 87,071,966 H56L possibly damaging Het
Olfr1245 T C 2: 89,575,034 R231G probably damaging Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pcdhga10 C T 18: 37,749,021 P612S probably damaging Het
Picalm A G 7: 90,191,704 N456S probably damaging Het
Pigo A G 4: 43,025,084 F5S probably benign Het
Pikfyve T C 1: 65,230,845 F563S probably damaging Het
Pm20d2 A G 4: 33,174,414 V403A probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rb1cc1 T A 1: 6,250,113 V1252D probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rmdn3 A T 2: 119,156,422 H41Q possibly damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Ror1 A G 4: 100,442,160 Y910C possibly damaging Het
Scn2a C T 2: 65,682,031 L171F probably benign Het
Sh3pxd2b A G 11: 32,411,505 E239G probably damaging Het
Snx27 G T 3: 94,520,235 T311K probably benign Het
Sspo T A 6: 48,492,490 L4459Q probably damaging Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Thap12 G T 7: 98,716,663 K679N probably damaging Het
Vmn2r65 T A 7: 84,946,651 H275L probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zfp229 C A 17: 21,745,862 H358N probably damaging Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Plod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Plod2 APN 9 92598614 missense probably damaging 0.99
IGL00945:Plod2 APN 9 92584496 missense probably benign 0.08
IGL01386:Plod2 APN 9 92606602 missense probably damaging 0.99
IGL01519:Plod2 APN 9 92595295 missense probably benign 0.00
IGL01836:Plod2 APN 9 92606498 splice site probably benign
IGL02490:Plod2 APN 9 92586842 missense probably benign 0.00
IGL02496:Plod2 APN 9 92607094 missense probably damaging 1.00
IGL02699:Plod2 APN 9 92607142 missense probably damaging 1.00
IGL02735:Plod2 APN 9 92595389 splice site probably benign
IGL03106:Plod2 APN 9 92573567 missense probably damaging 0.98
R0270:Plod2 UTSW 9 92584521 missense probably benign 0.10
R0546:Plod2 UTSW 9 92595335 missense probably damaging 1.00
R0589:Plod2 UTSW 9 92593746 missense probably benign
R0707:Plod2 UTSW 9 92605427 missense possibly damaging 0.91
R1491:Plod2 UTSW 9 92606584 missense probably benign 0.00
R1572:Plod2 UTSW 9 92603067 splice site probably benign
R1731:Plod2 UTSW 9 92584604 critical splice donor site probably null
R1895:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R1917:Plod2 UTSW 9 92581257 missense probably benign
R1946:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R3973:Plod2 UTSW 9 92598619 nonsense probably null
R3974:Plod2 UTSW 9 92598619 nonsense probably null
R4289:Plod2 UTSW 9 92602988 missense possibly damaging 0.89
R4423:Plod2 UTSW 9 92601989 missense probably benign 0.00
R4647:Plod2 UTSW 9 92605450 nonsense probably null
R4754:Plod2 UTSW 9 92606531 nonsense probably null
R4769:Plod2 UTSW 9 92595272 missense probably damaging 1.00
R5279:Plod2 UTSW 9 92581323 missense probably damaging 1.00
R5535:Plod2 UTSW 9 92606569 missense probably damaging 1.00
R5654:Plod2 UTSW 9 92593823 missense probably benign
R5764:Plod2 UTSW 9 92603021 missense probably damaging 0.97
R5885:Plod2 UTSW 9 92606656 critical splice donor site probably null
R5940:Plod2 UTSW 9 92591397 missense probably benign 0.39
R6917:Plod2 UTSW 9 92593770 missense possibly damaging 0.87
R7109:Plod2 UTSW 9 92573597 missense probably damaging 1.00
R7221:Plod2 UTSW 9 92584527 missense probably damaging 1.00
R7311:Plod2 UTSW 9 92584558 missense probably damaging 1.00
Z1088:Plod2 UTSW 9 92603035 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGTCCGCTCAATCCTCTC -3'
(R):5'- TTTAGCTCAGCTTCCGAACACC -3'

Sequencing Primer
(F):5'- TTCGGTACCCACGCAGTC -3'
(R):5'- AGGATGGCAAGCTGCTTC -3'
Posted On2015-04-06