Incidental Mutation 'R3953:Trim30d'
ID308049
Institutional Source Beutler Lab
Gene Symbol Trim30d
Ensembl Gene ENSMUSG00000057596
Gene Nametripartite motif-containing 30D
SynonymsTrim79, TRIM30-3
MMRRC Submission 040830-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3953 (G1)
Quality Score166
Status Validated
Chromosome7
Chromosomal Location104470014-104507849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104472521 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 339 (G339D)
Ref Sequence ENSEMBL: ENSMUSP00000033211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033211] [ENSMUST00000071069]
Predicted Effect probably damaging
Transcript: ENSMUST00000033211
AA Change: G339D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033211
Gene: ENSMUSG00000057596
AA Change: G339D

DomainStartEndE-ValueType
RING 15 58 1.72e-8 SMART
BBOX 91 132 5.25e-13 SMART
low complexity region 196 228 N/A INTRINSIC
Pfam:SPRY 350 491 1.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071069
AA Change: G189D

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065020
Gene: ENSMUSG00000057596
AA Change: G189D

DomainStartEndE-ValueType
coiled coil region 23 84 N/A INTRINSIC
Pfam:SPRY 198 346 1.1e-14 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000141063
AA Change: G112D
SMART Domains Protein: ENSMUSP00000115684
Gene: ENSMUSG00000057596
AA Change: G112D

DomainStartEndE-ValueType
PDB:4B3N|B 58 197 3e-19 PDB
Blast:SPRY 122 209 4e-13 BLAST
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Adgrf1 A G 17: 43,310,207 N445S probably benign Het
Aldh7a1 C A 18: 56,548,505 V198L probably damaging Het
Ank2 A T 3: 126,988,160 D6E probably damaging Het
Arhgap31 A G 16: 38,603,464 F747L probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cadps T C 14: 12,505,937 D711G probably damaging Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp4f18 C T 8: 72,000,957 R148H probably damaging Het
Dennd4a C A 9: 64,852,575 P321T probably damaging Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dnah2 G A 11: 69,454,103 T2715M probably damaging Het
Evc2 T C 5: 37,380,587 probably null Het
Fam69b C T 2: 26,635,567 P171L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Gucy1a2 T C 9: 3,582,704 probably benign Het
Gys1 C T 7: 45,440,046 P274S probably damaging Het
Hbq1a T C 11: 32,300,214 probably null Het
Herc1 C T 9: 66,433,793 Q1731* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lnx1 T C 5: 74,606,089 T455A probably benign Het
Mast2 A T 4: 116,313,729 H612Q probably damaging Het
Mcm9 G A 10: 53,563,344 H578Y probably damaging Het
Mefv A G 16: 3,715,400 S336P possibly damaging Het
Micu1 A T 10: 59,750,504 H134L probably benign Het
Mrgprb2 C T 7: 48,552,368 G203D possibly damaging Het
Ncapd2 T C 6: 125,170,734 I1179V probably damaging Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr1475 G A 19: 13,479,442 S252L probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Pcnx3 A G 19: 5,683,780 probably benign Het
Pi4ka A G 16: 17,285,281 probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptprb A G 10: 116,341,494 N1320S probably benign Het
Ralgapa2 C T 2: 146,435,964 V426I probably damaging Het
Rhobtb2 T C 14: 69,794,039 T546A possibly damaging Het
Robo1 A G 16: 73,024,338 D1331G probably damaging Het
Sgcz A G 8: 37,526,192 probably benign Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Slc44a5 A G 3: 154,171,572 D13G probably benign Het
Slco1a1 A T 6: 141,923,107 M377K probably damaging Het
St18 T A 1: 6,802,893 L284Q probably damaging Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tec T C 5: 72,782,177 probably null Het
Tln2 G A 9: 67,370,629 P368S probably damaging Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Vps13d A G 4: 145,148,880 S1686P probably damaging Het
Wdr41 A G 13: 94,997,063 E75G probably damaging Het
Other mutations in Trim30d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Trim30d APN 7 104472126 missense possibly damaging 0.81
IGL01818:Trim30d APN 7 104472060 missense probably damaging 1.00
IGL02552:Trim30d APN 7 104472416 missense probably damaging 0.98
IGL03000:Trim30d APN 7 104473269 missense probably benign 0.26
R0608:Trim30d UTSW 7 104472485 missense probably damaging 0.99
R0629:Trim30d UTSW 7 104487655 missense probably damaging 1.00
R1390:Trim30d UTSW 7 104483403 missense probably benign 0.41
R1460:Trim30d UTSW 7 104472104 missense probably benign 0.00
R1474:Trim30d UTSW 7 104472494 missense probably damaging 1.00
R1701:Trim30d UTSW 7 104484182 nonsense probably null
R1799:Trim30d UTSW 7 104483475 missense probably damaging 0.98
R2295:Trim30d UTSW 7 104487942 missense probably damaging 1.00
R3898:Trim30d UTSW 7 104483529 missense probably benign 0.01
R3954:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R3955:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R3957:Trim30d UTSW 7 104472521 missense probably damaging 1.00
R4086:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4087:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4089:Trim30d UTSW 7 104487800 missense probably damaging 1.00
R4580:Trim30d UTSW 7 104472558 missense possibly damaging 0.68
R4596:Trim30d UTSW 7 104472526 missense probably benign 0.02
R4926:Trim30d UTSW 7 104483357 missense probably benign 0.09
R5071:Trim30d UTSW 7 104487958 missense probably damaging 1.00
R5074:Trim30d UTSW 7 104487958 missense probably damaging 1.00
R5294:Trim30d UTSW 7 104472488 missense probably damaging 1.00
R5477:Trim30d UTSW 7 104472140 missense probably damaging 1.00
R5629:Trim30d UTSW 7 104487929 missense possibly damaging 0.87
R5743:Trim30d UTSW 7 104472328 nonsense probably null
R6178:Trim30d UTSW 7 104487995 start codon destroyed probably damaging 1.00
R6244:Trim30d UTSW 7 104487610 missense probably damaging 1.00
R6937:Trim30d UTSW 7 104483427 missense probably damaging 1.00
R7014:Trim30d UTSW 7 104483336 missense probably benign 0.01
R7323:Trim30d UTSW 7 104483348 missense probably benign 0.41
X0026:Trim30d UTSW 7 104487965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGTAGCCACATTTAGGC -3'
(R):5'- TGACTTTAAACAAGGCTTCTCCG -3'

Sequencing Primer
(F):5'- GCCACATTTAGGCTGAAACGTTAC -3'
(R):5'- GCTTAAGTTACAAATAAGGCTGTACC -3'
Posted On2015-04-17