Incidental Mutation 'R3953:Dennd5a'
ID308050
Institutional Source Beutler Lab
Gene Symbol Dennd5a
Ensembl Gene ENSMUSG00000035901
Gene NameDENN/MADD domain containing 5A
Synonyms1500012B19Rik, Rab6ip1, ORF37
MMRRC Submission 040830-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R3953 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location109893780-109960470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109905699 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 868 (M868T)
Ref Sequence ENSEMBL: ENSMUSP00000079295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080437] [ENSMUST00000106722]
PDB Structure
Strucure of RAB6(GTP)-R6IP1 complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000080437
AA Change: M868T

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079295
Gene: ENSMUSG00000035901
AA Change: M868T

DomainStartEndE-ValueType
uDENN 12 138 7.71e-45 SMART
DENN 202 390 9.28e-80 SMART
dDENN 512 588 4.06e-21 SMART
low complexity region 832 844 N/A INTRINSIC
RUN 884 947 4.9e-22 SMART
Pfam:PLAT 956 1062 1e-15 PFAM
RUN 1218 1278 3.69e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106722
AA Change: M844T

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102333
Gene: ENSMUSG00000035901
AA Change: M844T

DomainStartEndE-ValueType
uDENN 12 114 2.32e-39 SMART
DENN 178 366 9.28e-80 SMART
dDENN 488 564 4.06e-21 SMART
low complexity region 808 820 N/A INTRINSIC
RUN 860 923 4.9e-22 SMART
Pfam:PLAT 932 1038 2.8e-18 PFAM
RUN 1194 1254 3.69e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154002
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN-domain-containing protein that functions as a RAB-activating guanine nucleotide exchange factor (GEF). This protein catalyzes the conversion of GDP to GTP and thereby converts inactive GDP-bound Rab proteins into their active GTP-bound form. The encoded protein is recruited by RAB6 onto Golgi membranes and is therefore referred to as RAB6-interacting protein 1. This protein binds with RAB39 as well. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene are associated with early infantile epileptic encephalopathy-49. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 G A 14: 66,057,610 S262L probably damaging Het
Adgrf1 A G 17: 43,310,207 N445S probably benign Het
Aldh7a1 C A 18: 56,548,505 V198L probably damaging Het
Ank2 A T 3: 126,988,160 D6E probably damaging Het
Arhgap31 A G 16: 38,603,464 F747L probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cadps T C 14: 12,505,937 D711G probably damaging Het
Clspn ACGGCGGCGGC A 4: 126,566,437 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Cyp4f18 C T 8: 72,000,957 R148H probably damaging Het
Dennd4a C A 9: 64,852,575 P321T probably damaging Het
Dnah2 G A 11: 69,454,103 T2715M probably damaging Het
Evc2 T C 5: 37,380,587 probably null Het
Fam69b C T 2: 26,635,567 P171L probably benign Het
Fkbp8 T G 8: 70,534,867 S376A probably damaging Het
Gucy1a2 T C 9: 3,582,704 probably benign Het
Gys1 C T 7: 45,440,046 P274S probably damaging Het
Hbq1a T C 11: 32,300,214 probably null Het
Herc1 C T 9: 66,433,793 Q1731* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lnx1 T C 5: 74,606,089 T455A probably benign Het
Mast2 A T 4: 116,313,729 H612Q probably damaging Het
Mcm9 G A 10: 53,563,344 H578Y probably damaging Het
Mefv A G 16: 3,715,400 S336P possibly damaging Het
Micu1 A T 10: 59,750,504 H134L probably benign Het
Mrgprb2 C T 7: 48,552,368 G203D possibly damaging Het
Ncapd2 T C 6: 125,170,734 I1179V probably damaging Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr1475 G A 19: 13,479,442 S252L probably benign Het
Olfr566 A G 7: 102,856,617 C222R probably damaging Het
Pcnx3 A G 19: 5,683,780 probably benign Het
Pi4ka A G 16: 17,285,281 probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptprb A G 10: 116,341,494 N1320S probably benign Het
Ralgapa2 C T 2: 146,435,964 V426I probably damaging Het
Rhobtb2 T C 14: 69,794,039 T546A possibly damaging Het
Robo1 A G 16: 73,024,338 D1331G probably damaging Het
Sgcz A G 8: 37,526,192 probably benign Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Slc44a5 A G 3: 154,171,572 D13G probably benign Het
Slco1a1 A T 6: 141,923,107 M377K probably damaging Het
St18 T A 1: 6,802,893 L284Q probably damaging Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tec T C 5: 72,782,177 probably null Het
Tln2 G A 9: 67,370,629 P368S probably damaging Het
Tmem131l C A 3: 83,910,419 C1257F probably damaging Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Vps13d A G 4: 145,148,880 S1686P probably damaging Het
Wdr41 A G 13: 94,997,063 E75G probably damaging Het
Other mutations in Dennd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Dennd5a APN 7 109908372 missense probably benign
IGL01338:Dennd5a APN 7 109919404 missense possibly damaging 0.92
IGL01618:Dennd5a APN 7 109934095 missense probably damaging 1.00
IGL02047:Dennd5a APN 7 109934784 missense possibly damaging 0.92
IGL02277:Dennd5a APN 7 109897969 missense possibly damaging 0.61
IGL02492:Dennd5a APN 7 109933637 missense probably benign
IGL02697:Dennd5a APN 7 109894781 missense probably damaging 1.00
IGL02935:Dennd5a APN 7 109921307 missense possibly damaging 0.80
IGL02986:Dennd5a APN 7 109935524 missense probably benign
IGL03088:Dennd5a APN 7 109908381 missense probably damaging 1.00
IGL03156:Dennd5a APN 7 109919255 splice site probably benign
IGL03181:Dennd5a APN 7 109933658 missense probably damaging 1.00
big_pal UTSW 7 109919423 nonsense probably null
celestial UTSW 7 109901089 missense probably damaging 1.00
PIT4434001:Dennd5a UTSW 7 109933624 missense probably damaging 1.00
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0092:Dennd5a UTSW 7 109899806 missense possibly damaging 0.95
R0111:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R0517:Dennd5a UTSW 7 109934761 missense probably damaging 1.00
R0546:Dennd5a UTSW 7 109921426 missense probably benign 0.01
R0811:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0812:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0827:Dennd5a UTSW 7 109899731 missense probably damaging 1.00
R0831:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R1075:Dennd5a UTSW 7 109918601 missense probably benign
R1115:Dennd5a UTSW 7 109918761 missense probably damaging 1.00
R1128:Dennd5a UTSW 7 109921334 nonsense probably null
R1300:Dennd5a UTSW 7 109919407 missense probably benign
R1698:Dennd5a UTSW 7 109917380 splice site probably null
R1711:Dennd5a UTSW 7 109918712 missense probably benign 0.00
R1771:Dennd5a UTSW 7 109918686 missense probably damaging 0.98
R1803:Dennd5a UTSW 7 109898613 missense probably benign 0.00
R2064:Dennd5a UTSW 7 109898693 splice site probably benign
R2176:Dennd5a UTSW 7 109905120 intron probably null
R2182:Dennd5a UTSW 7 109933994 missense probably benign 0.03
R2852:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R2853:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R3035:Dennd5a UTSW 7 109921352 missense probably benign 0.00
R3835:Dennd5a UTSW 7 109934242 missense probably benign 0.00
R3954:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3955:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3957:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R4014:Dennd5a UTSW 7 109935481 critical splice donor site probably null
R4166:Dennd5a UTSW 7 109926825 critical splice donor site probably null
R4362:Dennd5a UTSW 7 109896343 missense probably damaging 1.00
R4567:Dennd5a UTSW 7 109899735 missense probably benign 0.06
R4700:Dennd5a UTSW 7 109921198 missense probably benign 0.01
R4734:Dennd5a UTSW 7 109896336 missense probably damaging 0.96
R4914:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4915:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4918:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4992:Dennd5a UTSW 7 109894712 missense probably damaging 0.98
R5011:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5013:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5034:Dennd5a UTSW 7 109899797 missense probably damaging 0.98
R5194:Dennd5a UTSW 7 109933729 missense probably damaging 1.00
R5359:Dennd5a UTSW 7 109897962 missense probably damaging 1.00
R5430:Dennd5a UTSW 7 109934240 missense probably damaging 1.00
R5586:Dennd5a UTSW 7 109905721 missense possibly damaging 0.72
R5607:Dennd5a UTSW 7 109919423 nonsense probably null
R5608:Dennd5a UTSW 7 109919423 nonsense probably null
R5783:Dennd5a UTSW 7 109894636 missense probably damaging 0.97
R5866:Dennd5a UTSW 7 109919360 missense probably benign 0.00
R5890:Dennd5a UTSW 7 109934221 missense probably benign 0.00
R6053:Dennd5a UTSW 7 109933745 missense probably damaging 1.00
R6247:Dennd5a UTSW 7 109898682 missense probably damaging 1.00
R6362:Dennd5a UTSW 7 109934265 nonsense probably null
R6446:Dennd5a UTSW 7 109894666 missense probably damaging 1.00
R6894:Dennd5a UTSW 7 109901118 missense probably damaging 1.00
R7061:Dennd5a UTSW 7 109905179 missense probably benign 0.19
R7115:Dennd5a UTSW 7 109894754 missense probably damaging 1.00
R7133:Dennd5a UTSW 7 109896242 critical splice donor site probably null
R7302:Dennd5a UTSW 7 109905699 missense probably damaging 0.98
Z1088:Dennd5a UTSW 7 109894747 missense possibly damaging 0.73
Z1088:Dennd5a UTSW 7 109905273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTATGCTCTTTCTCCTGGTAGAG -3'
(R):5'- TGATGGAGCCAATTGTTTGC -3'

Sequencing Primer
(F):5'- CTCCTGGTAGAGTCTGCAAAATG -3'
(R):5'- AGCCAATTGTTTGCTGTAGC -3'
Posted On2015-04-17