Incidental Mutation 'R3913:Tnks'
ID309504
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
SynonymsmTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
MMRRC Submission 040911-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3913 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location34826460-34965690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34873074 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 463 (S463R)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
PDB Structure
Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000033929
AA Change: S463R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: S463R

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209904
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh7 T A 3: 138,221,780 V29E probably damaging Het
Adra1d T A 2: 131,562,155 D5V probably damaging Het
Arid1b A G 17: 5,342,257 I2021V possibly damaging Het
Birc6 A T 17: 74,573,613 R462* probably null Het
Cchcr1 T C 17: 35,525,336 V341A probably damaging Het
Crybg1 T C 10: 43,998,763 D783G possibly damaging Het
Dcaf15 T C 8: 84,099,165 Y271C probably damaging Het
Dcun1d2 A C 8: 13,281,082 M16R probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnttip2 T C 3: 122,275,391 V85A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Exoc7 T C 11: 116,306,905 D27G probably benign Het
Gdpd5 A G 7: 99,438,339 D70G probably null Het
Glyr1 A G 16: 5,031,913 F199L probably damaging Het
Golga4 T A 9: 118,538,971 M414K probably damaging Het
Gpr132 C A 12: 112,853,020 W62L probably benign Het
Gpr179 A T 11: 97,334,765 V2188E probably benign Het
Ilf3 C T 9: 21,398,126 A526V possibly damaging Het
Ints10 T A 8: 68,813,620 S478T probably damaging Het
Kcnab2 A G 4: 152,395,232 V187A probably damaging Het
Kcnj15 C T 16: 95,296,470 T317I probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klhl30 T C 1: 91,359,444 V484A possibly damaging Het
Krt90 G A 15: 101,562,783 R15W probably damaging Het
Liph G T 16: 21,962,259 probably benign Het
Lrrc7 G A 3: 158,291,952 L158F probably damaging Het
Maml1 T C 11: 50,263,432 T602A probably benign Het
Mast4 A G 13: 102,758,669 L782P probably damaging Het
Mei4 A G 9: 81,890,263 K43R probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mst1r G A 9: 107,914,746 R827Q probably benign Het
Olfm1 A G 2: 28,208,174 T83A possibly damaging Het
Olfr1022 T C 2: 85,868,771 Y60H probably damaging Het
Olfr390 G T 11: 73,787,696 G253W probably damaging Het
Parp4 A G 14: 56,620,518 E869G probably damaging Het
Pate4 C A 9: 35,611,844 M1I probably null Het
Patj A G 4: 98,569,101 D1280G probably damaging Het
Ppargc1b T C 18: 61,311,376 S255G probably damaging Het
Rev3l A G 10: 39,820,556 I521M probably damaging Het
Rlim T C X: 103,962,661 T545A probably benign Het
Robo2 A T 16: 74,035,005 D262E probably damaging Het
Sec14l5 A G 16: 5,147,856 probably benign Het
Sema4b A G 7: 80,220,474 S467G probably benign Het
Setd2 C T 9: 110,551,046 R1310C probably damaging Het
Sh3d19 T C 3: 86,084,776 I37T probably damaging Het
Slc23a3 T A 1: 75,128,922 I422F probably benign Het
Snap91 T C 9: 86,792,557 T534A possibly damaging Het
Son A T 16: 91,660,111 probably benign Het
Tubb3 A G 8: 123,421,009 H227R possibly damaging Het
Tyw1 T A 5: 130,259,035 V36D probably damaging Het
Vwa5a T C 9: 38,734,743 I469T probably damaging Het
Zdhhc8 A G 16: 18,226,723 L311P possibly damaging Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTAAAGGCTCTTGTGGAAC -3'
(R):5'- GACAGACACACTTACTCATGTCAG -3'

Sequencing Primer
(F):5'- CACATGAAGCAAGCATGATTAGAC -3'
(R):5'- AGCCATTTTCTCTAATCCAGCATGG -3'
Posted On2015-04-17