Incidental Mutation 'R4159:Vmn2r3'
ID315650
Institutional Source Beutler Lab
Gene Symbol Vmn2r3
Ensembl Gene ENSMUSG00000091572
Gene Namevomeronasal 2, receptor 3
SynonymsEG637004
MMRRC Submission 041002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4159 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64258961-64287495 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 64287429 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 23 (Q23*)
Ref Sequence ENSEMBL: ENSMUSP00000134891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170244] [ENSMUST00000176328]
Predicted Effect probably benign
Transcript: ENSMUST00000170244
SMART Domains Protein: ENSMUSP00000126165
Gene: ENSMUSG00000091572

DomainStartEndE-ValueType
Pfam:ANF_receptor 64 479 4e-64 PFAM
Pfam:NCD3G 521 574 1.1e-17 PFAM
Pfam:7tm_3 605 842 2.9e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176328
AA Change: Q23*
SMART Domains Protein: ENSMUSP00000134891
Gene: ENSMUSG00000091572
AA Change: Q23*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 92 507 9.5e-66 PFAM
Pfam:NCD3G 549 602 8.8e-17 PFAM
Pfam:7tm_3 635 869 8.5e-48 PFAM
Meta Mutation Damage Score 0.616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
4932438A13Rik T A 3: 36,931,083 M854K probably benign Het
Adam4 T G 12: 81,420,032 D605A probably damaging Het
Adcy1 A G 11: 7,063,889 H97R probably damaging Het
Amdhd1 A G 10: 93,534,650 Y109H probably damaging Het
Ankhd1 A G 18: 36,589,540 N372S possibly damaging Het
Aoc2 G A 11: 101,325,296 M68I probably damaging Het
Aspscr1 G A 11: 120,708,676 A377T probably damaging Het
Cacnb1 G C 11: 98,012,274 C154W probably damaging Het
Ccdc186 G A 19: 56,793,492 R27* probably null Het
Clnk C A 5: 38,741,795 probably benign Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Fut8 T C 12: 77,393,749 L170P probably damaging Het
G3bp2 T C 5: 92,064,401 H217R probably benign Het
Gm19345 G A 7: 19,854,961 probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Met G T 6: 17,562,272 probably null Het
Mfsd3 T C 15: 76,701,745 L26P probably damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pde8a A G 7: 81,320,659 I510V probably benign Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Phkb T A 8: 86,021,533 probably null Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Slc15a5 G T 6: 138,072,940 T159K possibly damaging Het
Slc39a6 A G 18: 24,597,828 V362A possibly damaging Het
Spef2 A T 15: 9,676,321 D721E probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmem173 A T 18: 35,739,219 Y77N probably damaging Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Ttll8 T C 15: 88,917,241 N415D probably benign Het
Ube2d2a A T 18: 35,770,524 probably benign Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Unc79 A G 12: 103,070,253 probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vmn2r102 T A 17: 19,677,826 C368S probably damaging Het
Other mutations in Vmn2r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Vmn2r3 APN 3 64259883 missense probably damaging 1.00
IGL01468:Vmn2r3 APN 3 64274961 missense possibly damaging 0.57
IGL02032:Vmn2r3 APN 3 64275055 missense possibly damaging 0.95
IGL02405:Vmn2r3 APN 3 64271199 splice site probably benign
IGL02640:Vmn2r3 APN 3 64287395 missense probably benign
IGL02719:Vmn2r3 APN 3 64275610 missense probably damaging 1.00
IGL02746:Vmn2r3 APN 3 64259818 missense possibly damaging 0.74
IGL02952:Vmn2r3 APN 3 64278835 missense probably damaging 1.00
IGL03390:Vmn2r3 APN 3 64275346 missense possibly damaging 0.55
R0023:Vmn2r3 UTSW 3 64275366 missense probably damaging 0.99
R0433:Vmn2r3 UTSW 3 64275633 missense possibly damaging 0.51
R0647:Vmn2r3 UTSW 3 64275625 missense probably damaging 1.00
R1071:Vmn2r3 UTSW 3 64275276 missense possibly damaging 0.79
R1536:Vmn2r3 UTSW 3 64275117 missense probably damaging 1.00
R1806:Vmn2r3 UTSW 3 64275472 missense probably benign 0.03
R1806:Vmn2r3 UTSW 3 64287389 missense possibly damaging 0.73
R1852:Vmn2r3 UTSW 3 64259394 missense probably damaging 1.00
R1868:Vmn2r3 UTSW 3 64259116 missense probably damaging 1.00
R2072:Vmn2r3 UTSW 3 64275072 missense possibly damaging 0.87
R2240:Vmn2r3 UTSW 3 64259062 missense probably benign 0.44
R2446:Vmn2r3 UTSW 3 64275312 missense probably damaging 0.98
R4133:Vmn2r3 UTSW 3 64275717 missense probably damaging 0.99
R4494:Vmn2r3 UTSW 3 64275271 missense probably damaging 1.00
R4860:Vmn2r3 UTSW 3 64275601 missense probably benign 0.00
R4895:Vmn2r3 UTSW 3 64259761 missense probably benign 0.00
R4912:Vmn2r3 UTSW 3 64259197 missense probably damaging 1.00
R5018:Vmn2r3 UTSW 3 64271353 missense probably benign
R5033:Vmn2r3 UTSW 3 64259799 missense probably benign 0.09
R5126:Vmn2r3 UTSW 3 64259319 missense probably damaging 1.00
R5148:Vmn2r3 UTSW 3 64278826 missense probably damaging 1.00
R5414:Vmn2r3 UTSW 3 64259557 nonsense probably null
R5785:Vmn2r3 UTSW 3 64259023 missense possibly damaging 0.89
R5905:Vmn2r3 UTSW 3 64275277 missense probably benign 0.19
R5992:Vmn2r3 UTSW 3 64259647 missense probably damaging 1.00
R6028:Vmn2r3 UTSW 3 64275277 missense probably benign 0.19
R6331:Vmn2r3 UTSW 3 64278761 missense probably damaging 1.00
R6378:Vmn2r3 UTSW 3 64275096 missense probably damaging 1.00
R6775:Vmn2r3 UTSW 3 64275618 missense possibly damaging 0.88
R6822:Vmn2r3 UTSW 3 64287455 missense probably benign 0.30
R6826:Vmn2r3 UTSW 3 64274906 nonsense probably null
R6886:Vmn2r3 UTSW 3 64259506 missense probably damaging 1.00
R6971:Vmn2r3 UTSW 3 64259247 missense probably damaging 0.99
R7154:Vmn2r3 UTSW 3 64287311 missense probably benign 0.02
R7192:Vmn2r3 UTSW 3 64259943 missense probably benign 0.24
R7282:Vmn2r3 UTSW 3 64261404 missense possibly damaging 0.90
R7472:Vmn2r3 UTSW 3 64275532 missense probably benign 0.00
R7563:Vmn2r3 UTSW 3 64275349 missense possibly damaging 0.60
X0022:Vmn2r3 UTSW 3 64271248 missense possibly damaging 0.62
X0022:Vmn2r3 UTSW 3 64274968 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGGCTCCAAGGTATCCACTC -3'
(R):5'- GCAATCAGGTTAGGCACTCAC -3'

Sequencing Primer
(F):5'- AAGGTATCCACTCTTTTCTGGC -3'
(R):5'- GGTTAGGCACTCACACACTC -3'
Posted On2015-05-14